Báo cáo y học: "Advanced paternal age is a risk factor for schizophrenia in Iranians" pps

Báo cáo y học: "Advanced paternal age is a risk factor for schizophrenia in Iranians" pps

Báo cáo y học: "Advanced paternal age is a risk factor for schizophrenia in Iranians" pps

... 10:15 http://www.annals-general-psychiatry.com/content/10/1/15 Page 3 of 6 PRIMARY RESEARCH Open Access Advanced paternal age is a risk factor for schizophrenia in Iranians Morteza Naserbakht 1 , Hamid-Reza Ahmadkhaniha 2,3,4* , ... Ahmadkhaniha 2,3,4* , Bahareh Mokri 5 and Cassandra L Smith 6 Abstract Background: Since 1958 many, but not all studies have demonstrated that...

Ngày tải lên: 09/08/2014, 01:21

6 406 0
Báo cáo Y học: ik3-1/Cables is a substrate for cyclin-dependent kinase 3 (cdk 3) pdf

Báo cáo Y học: ik3-1/Cables is a substrate for cyclin-dependent kinase 3 (cdk 3) pdf

... expressed cdk3 in association with either cyclin E or cyclin A by transient transfection (Fig. 2A) . Kinase assays indicated that pRb- phosphorylating activity was prominently upregulated in the anti-cdk3 ... ZRXL (Z and X are typically basic) motif that would allow it to be a substrate by cyclin/cdk3 as well as cyclin/cdk2 through binding to cyclin, leading to speculation that bindin...

Ngày tải lên: 24/03/2014, 04:21

7 308 0
Báo cáo y học: "The P2X7 receptor is a candidate product of murine and human lupus susceptibility loci: a hypothesis and comparison of murine allelic products" potx

Báo cáo y học: "The P2X7 receptor is a candidate product of murine and human lupus susceptibility loci: a hypothesis and comparison of murine allelic products" potx

... is a cell death mechanism with characteristics that potentially have particular relevance to disease pathogenesis. Introduction Systemic lupus erythematosus (SLE) is a polygenic dis- ease, although ... this receptor is proinflammatory – suggesting a potential role in autoimmune disease. In this respect, SLE is of particular interest. Not only is SLE an inflammatory disorde...

Ngày tải lên: 09/08/2014, 06:22

8 430 0
Báo cáo y học: "Atherogenic lipid profile is a feature characteristic of patients with early rheumatoid arthritis: effect of early treatment – a prospective, controlled study" pps

Báo cáo y học: "Atherogenic lipid profile is a feature characteristic of patients with early rheumatoid arthritis: effect of early treatment – a prospective, controlled study" pps

... explained by traditional cardiac risk factors. Arthritis Rheum 2001, 44:2737-2745. 32. Dessein PH, Stanwix AE, Moomal Z: Rheumatoid arthritis and cardiovascular disease may share similar risk factors ... study Athanasios N Georgiadis 1 , Eleni C Papavasiliou 2 , Evangelia S Lourida 2 , Yannis Alamanos 3 , Christina Kostara 4 , Alexandros D Tselepis 2 and Alexandros A Drosos 1 1 Depart...

Ngày tải lên: 09/08/2014, 08:22

7 495 0
Báo cáo y học: "Leg-length inequality is not associated with greater trochanteric pain syndrome" pps

Báo cáo y học: "Leg-length inequality is not associated with greater trochanteric pain syndrome" pps

... statistical analysis and partici- pated in manuscript preparation. JCT participated in the study design, analysis, and interpretation and in manuscript prepara- tion. JRC and MCN participated in the ... Osteoarthritis Study, a multicenter population-based study of community-dwelling adults aged 50 to 79 years. Diagnosis of GTPS was based on a standardized physical examination perf...

Ngày tải lên: 09/08/2014, 10:23

5 340 0
Báo cáo y học: "Hand-grip strength is a simple and effective outcome predictor in esophageal cancer following esophagectomy with reconstruction: a prospective study" ppt

Báo cáo y học: "Hand-grip strength is a simple and effective outcome predictor in esophageal cancer following esophagectomy with reconstruction: a prospective study" ppt

... was defined as grip strength lower than 25 kg in the dominant hand. Other laboratory data, history of other co-morbidities and risk factors were also recorded for risk analysis. The stan- dard position ... pleural effusion requiring tube drainage. Surgical mortality was defined as either patients died within 30 days after operation or in- hospital death without discharge. Mortality w...

Ngày tải lên: 10/08/2014, 09:22

5 426 0
Báo cáo y học: "Advanced radiological work-up as an adjunct to decision in early reconstructive surgery in brachial plexus injuries" pptx

Báo cáo y học: "Advanced radiological work-up as an adjunct to decision in early reconstructive surgery in brachial plexus injuries" pptx

... in accordance with the Helsinki declaration. Statistical analysis Statistical analysis was performed using SPSS 17. The degree of agreement between the clinical findings and radiological findings ... Hayashi N, Yamamoto S, Tajiri Y, Yoshioka N, Masumoto T, Mori H, Abe O, Aoki S, Ohtomo K: Brachial plexus injury: clinical manifestations, conventional imaging findings, and the latest imaging...

Ngày tải lên: 10/08/2014, 10:20

7 358 0
Báo cáo y học: "High-Resolution Flow Cytometry: a Suitable Tool for Monitoring Aneuploid Prostate Cancer Cells after TMZ and TMZ-BioShuttle Treatment"

Báo cáo y học: "High-Resolution Flow Cytometry: a Suitable Tool for Monitoring Aneuploid Prostate Cancer Cells after TMZ and TMZ-BioShuttle Treatment"

... Intersti- tial radiation therapy with temporarily or permanent radioactive implants (brachytherapy) [7]. iv) The standard initial systemic therapy for locally advanced or metastatic disease is hormonal ... Nagahara S, Makita N, Tarumi Y, Kadomatsu K, and Takei Y. Systemic delivery of siRNA specific to tumor mediated by atelocollagen: Combined therapy using siRNA targeting Bcl-xL a...

Ngày tải lên: 26/10/2012, 09:48

10 408 0
Báo cáo khoa học: Human delta-lactoferrin is a transcription factor that enhances Skp1 (S-phase kinase-associated protein) gene expression pdf

Báo cáo khoa học: Human delta-lactoferrin is a transcription factor that enhances Skp1 (S-phase kinase-associated protein) gene expression pdf

... GCGCCGAGGACCCCG Internal S: ACAAAGACCTGGTAACTCA Internal F: GAACCTTACTCCACAATTAG Site-directed mutagenesis DS1 Skp1 S: CCCTGAAGAAACCAGAGATGGCCTCTGGGATGGGACTGGG F: CCCAGTCCCATCCCAGAGGCCATCTCTGGTTTCTTCAGGG DS2 Skp1 S: ... CCCAGTCCCATCCCAGAGGCCATCTCTGGTTTCTTCAGGG DS2 Skp1 S: GTGCTGTTAGCCCTTATTTCCTACTATTAAAGAGGCTTCCATGCCAAACATAGCC F: GGCTATGTTTGGCATGGAAGCCTCTTTAAATAGTAGGAAATAAGGGCTAACAGCAC DLf de...

Ngày tải lên: 30/03/2014, 08:20

16 363 0
Báo cáo y học: "Prevalence of anxiety disorders: a population-based epidemiological study in metropolitan area of Casablanca, Morocco" ppt

Báo cáo y học: "Prevalence of anxiety disorders: a population-based epidemiological study in metropolitan area of Casablanca, Morocco" ppt

... Epi Info software (CDC Atlanta). Statistical methods used univariate analysis; authors described sociodemographic characteristics and contingency tables of each disorder. Analysis of variance (ANOVA) ... difficulties on the field. Data analysis was performed on PC microcomputer using Epi info in its sixth version. Statistical analysis This study was a descriptive one. The data were analys...

Ngày tải lên: 08/08/2014, 21:20

6 416 0
Từ khóa:
w