Báo cáo y học: "Expert consensus on hospitalization for assessment: a survey in Japan for a new forensic mental health system" pot
Báo cáo y học: "Expert consensus on hospitalization for assessment: a survey in Japan for a new forensic mental health system" pot
... Psychiatry, Tokyo, Japan. 4 Chiba Psychiatric Medical Center, Chiba, Japan. 5 Mobara Mental Hospital, Chiba, Japan. 6 Chiba Aoba Municipal Hospital, Chiba, Japan. 7 Department of Psychiatry, ... Focus on psychiatry in Japan. Br J Psychiatry 2004, 164:88-92. 4. Nakatani Y, Kojimoto M, Matsubara S, Takayanagi I: New legislation for offenders with mental disorders in Jap...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo Y học: Structural studies on the core and the O-polysaccharide repeating unit of Pseudomonas aeruginosa immunotype 1 lipopolysaccharide pot
... 2-acet- amido-3-O-acetyl-2-deoxygalacturonamide, 2-formamido- 2-deoxygalacturonamide, 2-acetamido-2,6-dideoxyglucose and 2-( L -alanylamino)-2-deoxygalactose, respectively; all sugars are in the pyranose form and have ... b)andthesiteofattachmentof QuiNActoRha(atposition2or3)aswellaswith O-acetylation and amidation of the GalNA derivatives (Table 3). Because O-acetylation and amidation, whi...
Ngày tải lên: 24/03/2014, 03:21
Báo cáo hóa học: " Research Article On Intercell Interference and Its Cancellation in Cellular Multicarrier CDMA Systems Simon Plass German Aer" potx
... MC-CDMA systems. In [12, 13] the main focus was on the overall performance of an MC-CDMA sys- tem in a cellular environment. It was shown that there exist large performance degradations in the ... modulation alphabets (e.g., PSK or QAM), the bits are modulated to complex-valued data symbols with the chosen cardinality. Before each modulated signal can be spread with a Walsh-Hadama...
Ngày tải lên: 22/06/2014, 19:20
Báo cáo y học: "Association of functional variants of PTPN22 and tp53 in psoriatic arthritis: a case-control study" docx
... study was 39.6 years (standard deviation 11.3 years). The mean age at onset of psoriasis was 26.8 years (standard deviation 12.1 years) and the mean age at onset of PsA was 33.0 years (standard ... of Toronto. Informed consent was obtained from all patients. All PsA probands were Caucasians. Information was collected systematically and included age at onset of psoriasis and PsA, and disease ....
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: "Functional recovery after implantation of artificial nerve grafts in the rat- a systematic review" ppt
... The authors found poly(lactic acid), a copolymer of lactic acid and ε-caprolactone and a natural polymer of type I collagen to induce a significantly better axon outgrowth than ethylene-vinyl acetate ... by means of a systematic review. Materials and methods: A systematic review was conducted, searching MEDLINE, HTS and CENTRAL to identify all trials evaluating functional recovery o...
Ngày tải lên: 10/08/2014, 10:20
Báo cáo y học: " Relevance of JAK2V617F positivity to hematological diseases - survey of samples from a clinical genetics laboratory" docx
... phenol/chloroform-purified DNA samples. To avoid possible cross-contaminations, con- trol experiments with water replacing DNA samples were routinely performed. Statistical analysis Statistical analyses ... a small fraction of patients with other hematological dis- eases including AML, anemia, MDS, and lymphoma. Positive samples were not found at all in health donors of comparable ages...
Ngày tải lên: 10/08/2014, 21:23
Báo cáo Y học: Effect of the disease-causing mutations identified in human ribonuclease (RNase) H2 on the activities and stabilities of yeast RNase H2 and archaeal RNase HII pot
... 5¢-TG TG GAATTCAGTGGTGGTGGTGGTGGTGCCGGTAC CAATTATCTAGGG-3¢ for RNH 2A- R; 5¢-ATAT GAA TTCTCTCTAAGGAGATATACTTAT GACCGTTTC CAA CATTGGG-3¢ for RNH2B-F; 5¢-GGGG AAGCTTCTA GTGGTGGTGGTGGTGGTGCTTACGTTTAAAAAAT CCATC-3¢ for RNH2B-R; 5¢-ATAT AAGCTTCTCTCAA GGAGATATACTTATGACCAAAGATGCCGTG-3¢ ... substrate. These oligomeric substrates were prepared by hybridizing 1 lm of the 5¢-FAM-labeled 29 base DN...
Ngày tải lên: 17/03/2014, 17:20
Báo cáo Y học: The Fe-only nitrogenase and the Mo nitrogenase from Rhodobacter capsulatus A comparative study on the redox properties of the metal clusters present in the dinitrogenase components doc
... preparation to preparation. A decrease in specific activity was always accompanied by an increase in signal intensity, sugge sting that the g ¼ 2.01 signal is an artifact arising from an oxidatively ... Diphosphofructose- aldolase, Phosph oglyceraldehyd-deh ydrogenase, Milchsa ¨ ure- dehydrogenase, Glycerophosphat-dehydrogenase and P yruvat- kinase aus Kaninchenmuskulatur in einem Arbe...
Ngày tải lên: 18/03/2014, 01:20
Báo cáo Y học: Structural study on lipid A and the O-specific polysaccharide of the lipopolysaccharide from a clinical isolate of Bacteroides vulgatus from a patient with Crohn’s disease ppt
... constituents (Table 1). The approximate molar ratio of Rha to Man was 1 : 1. Abso- lute configuration analysis demonstrated that Man has a D configuration and Rha an L configuration. On methylation analysis, ... preparation. LPS was separated by hydrophobic interaction chroma- tography [12]. The preparation was subjected to stepwise separation on octyl-Sepharose using 0.1 M acetate buffer...
Ngày tải lên: 31/03/2014, 23:20
Báo cáo y học: "Differential clinical efficacy of anti-CD4 monoclonal antibodies in rat adjuvant arthritis is paralleled by differential influence on κ α NF-κB binding activity and TNF-α secretion of T cell" pot
... even accelerated the onset of AA by approximately 2 days (day 10), and ameliorated the arthritis only in the late phase (day 27). Differential clinical effects at the onset of AA were paralleled ... experimental system. Supplementary references S1. Karlsson R, Michaelsson A, Mattsson L: Kinetic analysis of mono- clonal antibody-antigen interactions with a new biosensor based analytical...
Ngày tải lên: 09/08/2014, 03:24