Báo cáo y học: "A 64-week, multicenter, open-label study of aripiprazole effectiveness in the management of patients with schizophrenia or schizoaffective disorder in a general psychiatric outpatient setting" pptx
Báo cáo y học: "Collaboration between general hospitals and community health services in the care of suicide attempters in Norway: a longitudinal study" ppt
... to a chain of care structure in the CHS in the hospital's catchment area. Maintaining a structured collaboration with aftercare providers andhaving a team or a coordinator in the hospital ... inhabitants in each municipalityand the degree of urbanisation of the municipality (rural,rural/urban or urban) were gathered from Statistics Nor-way. Information on the position of the informant ... aimed at establishing and maintainingstructured collaboration with aftercare providers and a team or coordinator at the hospital level might be impor-tant aspects in fostering the presence of a...
- 8
- 502
- 0
Báo cáo hóa học: " A Robust Parametric Technique for Multipath Channel Estimation in the Uplink of a DS-CDMA System" pot
... estimated using the infor-mation of already acquired delays. A cycle consists of P stepsand at the end of a cycle all delays have been estimated. Dur-ing the first cycle and while searching for τi,only(i ... currently an As-sociate Professor and Head of the Signal Processing and Commu-nications Laboratory. His research interests include fast algorithmsfor adaptive filtering and signal processing for ... approximated by a diagonal mat rix.Indeed, by applying the matrix inversion lemma to (A. 4), andtaking into account the approximate orthogonality of the in- volved vectors, we end up with the following...
- 12
- 438
- 0
Báo cáo y học: " A Dietary Supplement Containing Standardized Phaseolus vulgaris Extract Influences Body Composition of Overweight Men and Women"
... of a representative of the sponsor and of the Principal Investigator, and the representative formulas of the samples were identi-fied. Table 2 A general summary of the meal plan used in the ... extract prepared using heated processing conditions to substantially inactivate hemagglutinat-ing activity (HA) and trypsin inhibiting activity (TIA) while preserving alpha-amylase inhibiting ... simple, absorbable sugars, potentially reducing carbohydrate-derived calories [30,31]. Also, slowing of the rapid absorption of carbohydrates would favorably influence the insulin system that could,...
- 8
- 740
- 1
Tài liệu Báo cáo Y học: A Raman optical activity study of rheomorphism in caseins, synucleins and tau New insight into the structure and behaviour of natively unfolded proteins pot
... dierential scanning cal-orimetry, of bovine b-andj-casein, recombinant human a- ,b-andc-synuclein, together with the A3 0P and A5 3T mu-tants of a- synuclein associated with familial cases of Par-kinson's ... and A5 3T mutants of a- synuclein that cause f amilial c ases of Parkinson's disease.Unfortunately the quality of s ome of these syn uclein ROAspectra i s generally not as good as that of ... corpora amylacea has recently beenreported [28]. Such stones form in the mammary glandduring lactation and contain a group of amyloid-stainingpeptides that start at position 81 of a S2-casein....
- 9
- 667
- 0
Báo cáo y học: " Pregnancy and delivery while receiving vagus nerve stimulation for the treatment of major depression: a case report" pot
... contributionsMMH was the principal investigator of the VNS pilot study. DS was the study coordinator. KT assisted in dataanalysis and manuscript preparation.Acknowledgements The authors gratefully acknowledge ... patient, a Caucasian woman aged 28 years with a DSM-IV diagnosis of unipolar depression, wasenrolled in the acute and long-term phases of the pilot study of VNS therapy for TRD. At acute-phase study ... motor activity, heart rate variability [15], andblunted pain response [19,20]. Increased dosing of SSRIsmay be required to maintain euthymia during later stages of pregnancy [21], which may exacerbate...
- 7
- 453
- 0
Báo cáo y học: "Placenta Percreta-Induced Uterine Rupture Diagnosed By Laparoscopy in the First Trimester"
... pregnancy can cause a delay in the diagnosis and appropriate treatment. The first laparoscopic surgery during pregnancy was cholecystectomy, performed in 1991 [14]. Thereafter, laparoscopy ... placenta percreta at 14 weeks of gestation. Case Report A 35-year-old pregnant woman (gravida 5, para 2), with a history of 2 vaginal term deliveries and 2 spontaneous abortions treated by ... bleeding was detected; therefore, total abdominal hysterectomy was performed. The patient was discharged without any complications. Pathological analysis of the uterine specimen revealed placenta percreta...
- 4
- 503
- 0
Báo cáo khoa học: A steady-state modeling approach to validate an in vivo mechanism of the GAL regulatory network in Saccharomyces cerevisiae ppt
... determined by the state of the upstream regulatory element of the GALgenes in the nucleus. The regulatory protein may bind to the upstream regulatory element constituting a protein–DNA interaction ... Furthermore, the status of one binding site could in uence the binding of the regulatory protein to the other,representing cooperativity [5,6]. A regulatory protein maybe the product of the same ... individualelements, which are captured by parameters s uch as the binding constants and the extent of autoregulation. The regulatory proteins may reside either in the nucleus or in the cytoplasm or in both, thus...
- 11
- 490
- 0
Báo cáo Y học: Cold induces stress-activated protein kinase-mediated response in the fission yeast Schizosaccharomyces pombe pot
... DISCUSSION The main aim of this study was to analyse the cold shockresponse in S. pombe,ayeastthatdisplaysacascadeofstress activated protein kinases homologous to the SAPKpathway present in higher ... treatment at 15 °C and was maintained for atleast 3 h. Besides, the kinetics of Atf1p phosphorylationmatched closely with Sty1p activation (see Fig. 1). Also, the level of Atf1p increased at ... as an internal standardfor the RNA amount loaded in each lane. To establishquantitative conclusions, the level of mRNAs was quanti-fied in a Phosphorimager (Molecular Dynamics) andcompared with...
- 10
- 412
- 0
Báo cáo khoa học: a-1 Antitrypsin binds preprohepcidin intracellularly and prohepcidin in the serum pdf
... antitrypsin deficiency may be the reason for the disturbance in their iron homeostasis.Abbreviations A1 AT, a- 1 antitrypsin; AA, amino acid; CTCK, carbenicillin–tetracycline–chloramphenicol–kanamycin; ... that A1 AT is increased early in inflammation. Its mainfunction is to inhibit elastase released from granulo-cytes. Consequently, the availability of A1 AT forprohepcidin may actually decrease in acute ... directly involved in ironregulation. It is synthesized as an 84-amino-acid (AA)preprohormone, and is present in the plasma as a mature 25-AA peptide and as a 60-AA prohormoneform. Maturation...
- 10
- 678
- 0
Báo cáo Y học: Calcium-binding by p26olf, an S100-like protein in the frog olfactory epithelium pot
... primers:AACTTCAAACAGTTTGAGCAG for EF -A- mutation,GACTTTCAACAGTTTCTCAAC for EF-B-mutation, GATTACACACAGTTCGAGGCA for EF-C-mutation, AATTTCCAGCAGTTCATGAAC for EF-D-mutation. The under-lined ... may be the case that the mutation from glutamate to glutamine in the mutants induced a similar EF-hand conformational changethat occurs on the binding of Ca21 in the wild-type. If this is the ... 8B). (a) The first Ca21-binding to a high affinity site, EF-B,induces a conformational change of p26olf, which probablyincreases the affinity for Ca21 of EF -A to result in the secondCa21-binding...
- 8
- 509
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM