Báo cáo khoa học: " Biomass production and stool mortality in hybrid poplar coppiced twice a year" ppt

Báo cáo khoa học: " Biomass production and stool mortality in hybrid poplar coppiced twice a year" ppt

Báo cáo khoa học: " Biomass production and stool mortality in hybrid poplar coppiced twice a year" ppt

... biomass pro- duction. Leaves accounted for over 50% of Note Biomass production and stool mortality in hybrid poplar coppiced twice a year D Auclair L Bouvarel 1 INRA, Station ... dominants were expressed as means for each treatment. They did not include dead stools. Biomass data, ex- pressed on a land area basis, included all stools....

Ngày tải lên: 08/08/2014, 23:22

7 250 0
Tài liệu Báo cáo khoa học: "Balancing Clarity and Efficiency in Typed Feature Logic through Delaying" docx

Tài liệu Báo cáo khoa học: "Balancing Clarity and Efficiency in Typed Feature Logic through Delaying" docx

... goal (farg(synsem,X,SynVal), farg(loc,SynVal,LocVal), farg(cat,LocVal,CatVal), farg(head,CatVal,HdVal), whentype(verb,HdVal,(farg(marking,CatVal,MkVal), whentype(fin,MkVal, (X=synsem:loc:cat:head:vform:bse))))). (6) ... Modularity: the cost in clarity Semantic types and inheritance serve to organize the constraints and overall structure of an HPSG grammar. This is certainly a familiar...

Ngày tải lên: 20/02/2014, 15:21

8 449 0
Tài liệu Báo cáo khoa học: "Object clitics and clitic climbing in Italian HPS Ggrammar" docx

Tài liệu Báo cáo khoa học: "Object clitics and clitic climbing in Italian HPS Ggrammar" docx

... lure, and I. Sag. Generalized Phrase Structure Grammar. Blackwell, 1985. [Hinrichs and Nakazawa, 1990] E. Hin- richs and T. Nakazawa. Subcategorization and VP Structure in German. In Hughes, ... [Pollard andSag, 1987] C. Pollard and I. Sag. Information-Based Syntax and Semantics. Funda- mentals., volume 1. CSLI, 1987. [Pollard and Sag, 1993] C. Pollard and I....

Ngày tải lên: 22/02/2014, 10:20

6 399 0
Báo cáo khoa học: Space, time and nitric oxide – neuronal nitric oxide synthase generates signal pulses pptx

Báo cáo khoa học: Space, time and nitric oxide – neuronal nitric oxide synthase generates signal pulses pptx

... University and Veterans Affairs Medical Center, Durham, NC, USA Introduction Biological signaling takes place across spatial and tem- poral regimes spanning many orders of magnitude, and has applications ... nNOS, 1 mm arginine, 12 lm calmodulin and 100 lm CaCl 2 in air-saturated BTP at pH 7.5 with 1 mm NADPH. Data collection and preliminary analysis of spectral stopped flow data w...

Ngày tải lên: 07/03/2014, 00:20

12 402 0
Báo cáo khoa học: Molecular characterization and gene disruption of mouse lysosomal putative serine carboxypeptidase 1 ppt

Báo cáo khoa học: Molecular characterization and gene disruption of mouse lysosomal putative serine carboxypeptidase 1 ppt

... blot using the rabbit a- Scpep1 antibody. A mixture of molecular mass standard proteins, including IgG (160 kDa), albumin (67 kDa), ovalbumin (43 kDa) and ribonuclease A (13.7 kDa), was applied ... intracellular processing into a mature dimer consisting of a 35 kDa N-terminal fragment and a so far unknown 18 kDa C-terminal fragment and the glycosylation status of the mature S...

Ngày tải lên: 07/03/2014, 03:20

14 362 0
Báo cáo khoa học: Metabolomics, modelling and machine learning in systems biology – towards an understanding of the languages of cells potx

Báo cáo khoa học: Metabolomics, modelling and machine learning in systems biology – towards an understanding of the languages of cells potx

... Statistical Learning: Data Mining, Inference and Prediction. Springer-Verlag, Berlin. 297 Han J & Kamber M (2001) Data Mining: Concepts and Techniques. Morgan Kaufmann, San Francisco. 298 Ananiadou ... Krallinger M, Andres E, Tamames J, Blaschke C & Valencia A (2005) Text mining for meta- bolic pathways, signaling cascades, and protein net- works. Sci STKE pe21. 307 Vailaya A...

Ngày tải lên: 07/03/2014, 12:20

22 706 0
Báo cáo khoa học: Calcium, mitochondria and oxidative stress in neuronal pathology Novel aspects of an enduring theme pdf

Báo cáo khoa học: Calcium, mitochondria and oxidative stress in neuronal pathology Novel aspects of an enduring theme pdf

... Ca 2+ paradox Paradoxical Ca 2+ increases were originally described in isolated heart preparations [195] and subsequently shown to be associated with tissue damage in this and other organs, including ... have also observed the appearance of a nonselective, noninacti- vating cation conductance upon reducing extracellular Ca 2+ and Mg 2+ in cultures of cortical neurons, as well as...

Ngày tải lên: 07/03/2014, 12:20

18 549 0
Báo cáo khoa học: "Discourse Pragmatics and Ellipsis Resolution in Task-Oriented Natural Language Interfaces" pptx

Báo cáo khoa học: "Discourse Pragmatics and Ellipsis Resolution in Task-Oriented Natural Language Interfaces" pptx

... utterance. Taking advantage of the fact that a case frame analysis of a sentence or object description captures the meaningful semantic relations among its constituents in a canonical manner, a ... meaningless in the current domain. In these instances the semantic relations captured in a case frame representation and not in a semantic grammar parse tree prove imm...

Ngày tải lên: 08/03/2014, 18:20

5 417 0
Báo cáo khoa học: Characterization, localization and possible anti-inflammatory function of rat histone H4 mRNA variants potx

Báo cáo khoa học: Characterization, localization and possible anti-inflammatory function of rat histone H4 mRNA variants potx

... AATAAA HN 55 CCACACCATCAGGCTGTGGATACATAGATAAGGCAACATGG 95 TATAAA B H4g –66 CGCCTGTGGTCTTCAATCAGGTCCGCAGAAGGTCTATTTAAA )25 *CTTTT H4s –63 TCCCTGCTGTTTTCAAACAGGTCCGCTCCCAGGAAATATAAGC )21 *CTGTA H4-v.1 )80 CGCTCCCTGTTTTCACTCCGGTCCGCAAGTTCCATATAAGA )40 *GAGCA HN )72 CACTTGAAGTTCTCAACCAGGTCCGATAAGAGTGTATACTT -34 *TGGAA a Underlined ... Sequence characteristics Poly (A) signal c Cap site A H4g...

Ngày tải lên: 16/03/2014, 13:20

14 429 0
Báo cáo khoa học: "Combining Deep and Shallow Approaches in Parsing German" pptx

Báo cáo khoa học: "Combining Deep and Shallow Approaches in Parsing German" pptx

... shallow approach based on machine learning and a cascaded finite-state parser with a hand-crafted grammar. It dis- cusses several ways to combine them and presents evaluation results for the two in- dividual ... Tony Rose, Amanda Clare, and Aaron Kotcheff. 2001. A natural language system for re- trieval of captioned images. Journal of Natural Lan- guage Engineering, 7(2):117–142....

Ngày tải lên: 17/03/2014, 06:20

8 417 0
Từ khóa:
w