Báo cáo khoa học: "Prevalence and demographics of anxiety disorders: a snapshot from a community health centre in Pakistan" ppsx
... found between anxiety and marital status (p = 0.342). Similarly, no association between anxiety and family income, and anxiety and occupational status existed. In the final multivariate model, only ... hospital clinic in Kara- chi, Pakistan. J Pak Med Assoc 2006, 56(5):243-247. 24. Winkvist A, Akhtar H: Images of health and health care options among low income women...
Ngày tải lên: 08/08/2014, 23:20
... C)AATTTC-3¢ PsCBL (degenerate forward) 45¢-GTATCAGCTTC(C ⁄ T)TCAAATGTC-3¢ PsCBL (degenerate reverse) 55¢-CCATCACAAGAAACTAGAGAAAC-3 PsCIPK (5¢UTR forward) 65¢-TTAAGTACTATAAAT-ACACAGCCTA-3¢ PsCIPK (3¢UTR ... T)GC(C ⁄ G ⁄ T)AAGGT-3¢ PsCIPK (degenerate forward) 25¢-ACAAA (A ⁄ C )A( A ⁄ G) (A ⁄ G ⁄ T )A( C ⁄ T) (A ⁄ C ⁄ G)ACACCACAAGACC)3¢ PsCIPK (degenerate reverse) 35¢-CTTAT(C ⁄ G)AACAAGGAA (A...
Ngày tải lên: 19/02/2014, 07:20
... D, Marineau D, et al: Patient safety in the ambulatory setting. A clinician-based approach. J Gen Intern Med 2004, 19(7):719-725. 11. Sandars J, Esmail A: The frequency and nature of medical error ... most of their medical care in general practice, but to date adequate data on the prevalence of patient safety incidents in general practice are not available [2,3]. In the Net...
Ngày tải lên: 10/08/2014, 10:23
báo cáo khoa học: " Prevalence and correlates of HIV, syphilis, and hepatitis B and C infection and harm reduction program use among male injecting drug users in Kabul, Afghanistan: A cross-sectional assessment" ppsx
... and marginally associated with initiating injecting outside Afghanistan (Table 2). HCV Ab was independently asso- ciated with initiat ing inject ing outside Afghanis tan, ever having an abscess, ever sharing ... this article as: Todd et al.: Prevalence and correlates of HIV, syphilis, and hepatitis B and C infection and harm reduction program use among male injecting drug users i...
Ngày tải lên: 11/08/2014, 18:20
Báo cáo khoa học: " Prevalence and incidence of severe sepsis in Dutch intensive care unit" pdf
... incidence of diseases such as coronary heart disease and cerebrovascular accident, but it is comparable with the incidence of breast cancer, lung cancer and Parkinson's disease in The Netherlands. ... the estimated length of stay, and the capacity of the participating ICUs relative to the national intensive care capacity. Results The participating ICUs had 442 beds availa...
Ngày tải lên: 12/08/2014, 20:20
Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt
... and ACCAGCTGGGCCAACATTTC; collagen III: TGGACAGATGCTGGTGCTGAG and GAAGGCCAG CTGTACATCAAGGA; alpha smooth muscle actin (a- SMA): AGCCAGTCGCCATCAGGAAC and CCGG AGCCATTGTCACACAC; and glyceraldehyde-3-phosphate dehydrogenase: ... CACGAG-3¢;TNF -a: 5¢-AACTCGAGTGACAAGCCCGTAG-3¢ and 5¢-GTAC CACCAGTTGGTTGTCTTTGA-3¢; IL-10: 5 ¢-CAGACCC ACATGCTCCGAGA-3¢ and 5¢-CAAGGCTTGGCAA CCCAAGTA-3¢; c...
Ngày tải lên: 18/02/2014, 04:20
Báo cáo khoa học: "Characterization and localization of the unique Marek''''s disease virus type 2 ORF873 gene product" ppsx
... using the primers 5'- CCGCGATCG ATGAACATTTCGAATTA-3' (ORF873F) and 5'-CGCTCTAGA CTACTGTTCACTCGTAT-3' (ORF873R), which created Pst I and Xba I sites (underlined) on the 5' ... obtained from Sf9 cells and designated as rAcORF873. As a negative control, the baculovirus recombinant cAcNPV was prepared by cotransfection with the parent vector pVL1392 and Bacu...
Ngày tải lên: 07/08/2014, 17:23
Báo cáo khoa học: "Simulation and comparison of silvicultural alternatives for even-aged Pinus pinaster Ait stands in Galicia (Northwestern Spain)" pps
... Optimizing thinning and rotation in a stand of Pinus sylvestris on a drained peatland site, Scand. J. For. Res. 11 (1996) 182–192. [18] Miina J., Preparation of stand management models using simulation ... specific treatment history using initial basal area and age as explanatory variables [10]. Thus, the simulator allows the evaluation of a relatively wide range of silvic...
Ngày tải lên: 08/08/2014, 14:22
báo cáo khoa học: " Identification and characterization of the Nonrace specific Disease Resistance 1 (NDR1) orthologous protein in coffee" doc
... ATG GTG CAA CAG CAG AAC CAA GAA A- 3’. The primers used for obtaining the single HA-tagged version were CaNDR1-Forward 4 and CaNDR1-Reverse 2 (5’ -CTA CAA CAG CAG AAC CAA GA-3’). PCR fragments ... were taken 7 days after inoculation. (b) and (c) Bacterial growth was monitored in planta by assaying leaf samples 0, 2, and 4 days post-inoculation. CaNDR 1a- expressing lines (T3-1, T3-2...
Ngày tải lên: 11/08/2014, 11:21
báo cáo khoa học: " Identification and characterisation of seed storage protein transcripts from Lupinus angustifolius" docx
... awareness in many societies of the escalating incidence of obesity and the associated risk of diabetes and cardiovascular disease, NLL is an excellent candi- date as a healthy food. The major proteins ... human health food as the grain is high in protein and dietary fibre, gluten-free and low in fat and starch and thus has a very low Glycaemia Index [1]. Like oth...
Ngày tải lên: 11/08/2014, 11:21