Báo cáo khoa học: "Suicide in deaf populations: a literature review" ppsx

... Glickman, 2006 Prevalence study To examine demographic and clinical characteristics of deaf and hearing psychiatric in- patients A total of 64 deaf adult patients of specialist deaf unit at Westborough ... behaviours in deaf popula-tions.Risk and associated factors for suicide in deaf peopleThe literature suggests that a number of factors are associ-ated with suicide in deaf and hearing-impaired ... Health and non-governmental organisations [3,5] alsoreveal increased difficulties for deaf people in accessingmental health and social care services. These factors mayput deaf individuals at...

Báo cáo khoa học: Expression in yeast of a novel phospholipase A1 cDNA from Arabidopsis thaliana docx

... 353AACGACGATGAAAACGCCGGCGAGGTGGCGGATCGTGATCCGGTGCTTCTAGTATCTGGAATTGGAGGCTCTATTCTGCATTCTAAGAAGAAGAATTCAAAGTCTGAAATTCGGGTTTGTATATAGGTACCTTAACCAGAATCAACTACTTTGTG 354ATATATGGATCCATGGGCTGGATTCCGTGTC ... H409LGGAGTGTCCTTCTATAACATATTTGGAGTGTCACTTAATACACC Y346FGTCACTATCATCTCCCATGCAATGGGAGGACTTATGGTTTC S17 7A CATATGTAGATGGAGCTGGAACTGTCCCTG D38 4A GGAGTGTCACTTAATGCACCCTTTGATGTTTG T35 2A 3754 A. Noiriel ... below and that w ith the complementary sequence.NumberGene cloningATATATGGATCCATGTCTCTATTACTGG AAGAGATC 337TATATAGGTACCTTATGCATCAACAGAGACACTTAC 338ATATATGGATCCATGGGCTGGATTCCGTGTCCGTGCTGGGGAACC...

Báo cáo khoa học: "Delineation in thoracic oncology: a prospective study of the effect of training on contour variability and dosimetric consequences" potx

... ML, Kader AS, Beckham WA, Olivotto IA: Target volume delineation for partial breast radiotherapy planning: clinical characteristics associated with low interobserver concordance. Int J Radiat ... respiratory gating. Lung Cancer 2006,51:41-51. 15. Kepka L, Bujko K, Garmol D, Palucki J, Zolciak-Siwinska A, Guzel-Szczepiorkowska Z, Pietrzak L, Komosinska K, Sprawka A, Garbaczewska A: Delineation ... collected before and after a theoretical course. Delineation was improved after education. Our study also demonstrates that incorporating a practical delineation workshop during training improves...

báo cáo khoa học: "Safety in home care: A research protocol for studying medication management" pdf

... collaborators fromthe project's inception, including provincial health minis-tries, national health information, patient safety, andaccreditation bodies, and provincial and federal fundingpartners ... tex-tual data; understanding and comparing across severalsources of data, synthesizing the data to capture mean-ings, constructing theoretical relationships from the data,and explaining the ... The shared interaction and influence between theresearchers and participants will generate data and pro-duce findings that are meaningful and useful to the par-ticipants and to all stakeholders.Competing...

Báo cáo khoa hoc:" Pregnancy in dialysis patients: a case series" ppt

... SabryAddress: Prince Salman Center for Kidney Diseases, Riyadh, Kingdom of Saudi ArabiaEmail: Khalid A Al-Saran* - khalid_aln@yahoo.co.uk; Alaa A Sabry - asabry20@yahoo.com* Corresponding author ... CentralPage 1 of 4(page number not for citation purposes)Journal of Medical Case ReportsOpen AccessCase reportPregnancy in dialysis patients: a case seriesKhalid A Al-Saran* and Alaa A SabryAddress: ... complications and a considerable risk of renal disease progression. Due to substantial improvements in antenatal andneonatal care, fetal outcome has improved considerably in the last two decade. A Saudi...

báo cáo khoa học:" Polyp in concha bullosa: a case report and review of the literature" pot

... content details. Allauthors read and approved the final manuscript.References1. Yanagisawa E: Concha bullosa polyp. In Atlas of Rhinoscopy: Endo-scopic Sinonasal Anatomy and Pathology Ch ... Edited by: Yanagisawa E.San Diego, Singular- Thompson Learning; 2000. 2. Mirante JP, Christmas DA, Yanagisawa E: Polyps arising in a con-cha bullosa of the middle turbinate. Ear Nose Throat J 2003,82:241-242.3. ... concha bullosapolyp in a 45-year-old man. The clinical presentation,radiological and endoscopic findings, and managementapproach for this case are discussed.Case presentation A 45-year-old man...

báo cáo hóa học: " Bicarbonate in diabetic ketoacidosis - a systematic review" pptx

... ketonemia, including a slower decline in ketonemia in the first hour of bicarbonate infusion in a RCT [13], and an increase in plasma acetoacetatelevels during the initial three hours of bicarbo nate ... the administration of* Correspondence: Rinaldo.BELLOMO@austin.org.au1Department of Intensive Care, Austin Health, Melbourne, Victoria, AustraliaFull list of author information is available at ... HealthSystem (NUHS) Singapore. The funds were utilized for his clinical andresearch training in Austin Health, Melbourne, Australia.Author details1Department of Intensive Care, Austin Health, Melbourne,...

báo cáo khoa học: "Diverticulitis complicated by pylephlebitis: a case report" ppsx

... cytosis and elevated alkaline phosphatase. A computed tomography scan revealed portal veinthrombosis and a sigmoid diverticulitis with an abscess. Our patient was given pipercillin-tozabactam followed ... improvedclinically and was discharged home on ertapenem and enoxaparin. A follow-up computed tomography scan twoweeks later showed a new pelvic abscess that was drained by a pigtail catheter but ... four days. She improved clinically and was dis-charged home on ertapenem and enoxaparin. A follow-up CT scan two weeks later showed a new pelvic abscess7.5 × 6 cm that was drained by a pigtail...

báo cáo khoa học: " Two-stimuli manipulation of a biological motor" ppsx

... myosin, kinesin anddynein move in linear fashion. Other motors performrotary motion, e.g. the bacterial flagellar motor or theenzyme F1-ATPase. F1-ATPase hydrolyses ATP into ADPand inorganic ... AssayF1-ATPase was biotinylated at a single cysteine residue in subunit γ using biotin-(PEAC)5-maleimide (Dojindo,Japan), as described elsewhere [10]. The biotinylated F1-ATPase (30 nM) in ... ofdistinct rotational substeps by submillisecond kinetic analy-sis of F1-ATPase. Nature 2001, 410:898-904.8. Itoh H, Takahashi A, Adachi A, Noji H, Yasuda R, Yoshida M, KinositaK: Mechanically...

báo cáo khoa học: "Changes in the distribution of the genetic variance of a quantitative trait in small populations of Drosophila melanogaster" docx

... within-line genetic covariance will decrease as (1 - FJ cov A, cov A being the genetic covariance in the base population, and its variance will increase alsotowards an asymptotic ... variance within lines will also change. Its meanwill decrease with time as (1 - FJ VA, while its variance will increase and rapidly approa-ch an asymptotic value, largely ... varianceof a quantitative trait in small populationsof Drosophila melanogasterC.López-Fanjul,J. Guerra A. Garc a Universidad Complutense, Facultad de Ciencias Bioldgicas,...

Xem thêm