Báo cáo khoa học: "Suicide in deaf populations: a literature review" ppsx

Báo cáo khoa học: "Suicide in deaf populations: a literature review" ppsx

Báo cáo khoa học: "Suicide in deaf populations: a literature review" ppsx

... Glickman, 2006 Prevalence study To examine demographic and clinical characteristics of deaf and hearing psychiatric in- patients A total of 64 deaf adult patients of specialist deaf unit at Westborough ... behaviours in deaf popula- tions. Risk and associated factors for suicide in deaf people The literature suggests that a number of factors are associ- ated with suicid...

Ngày tải lên: 08/08/2014, 23:20

9 359 0
Báo cáo khoa học: Expression in yeast of a novel phospholipase A1 cDNA from Arabidopsis thaliana docx

Báo cáo khoa học: Expression in yeast of a novel phospholipase A1 cDNA from Arabidopsis thaliana docx

... 353 AACGACGATGAAAACGCCGGCGAGGTGGCGGATCGTGATCCGGTG CTTCTAGTATCTGGAATTGGAGGCTCTATTCTGCATTCTAAGAAGA AGAATTCAAAGTCTGAAATTCGGGTTTG TATATAGGTACCTTAACCAGAATCAACTACTTTGTG 354 ATATATGGATCCATGGGCTGGATTCCGTGTC ... H409L GGAGTGTCCTTCTATAACATA TTTGGAGTGTCACTTAATACACC Y346F GTCACTATCATCTCCCAT GCAATGGGAGGACTTATGGTTTC S17 7A CATATGTAGATGGAGCTGGAACTGTCCCTG D38 4A GGAGTGTCACTTAAT GCACCCTTTGATGTTTG T35 2A 37...

Ngày tải lên: 30/03/2014, 15:20

13 448 0
Báo cáo khoa học: "Delineation in thoracic oncology: a prospective study of the effect of training on contour variability and dosimetric consequences" potx

Báo cáo khoa học: "Delineation in thoracic oncology: a prospective study of the effect of training on contour variability and dosimetric consequences" potx

... ML, Kader AS, Beckham WA, Olivotto IA: Target volume delineation for partial breast radiotherapy planning: clinical characteristics associated with low interobserver concordance. Int J Radiat ... respiratory gating. Lung Cancer 2006,51:41-51. 15. Kepka L, Bujko K, Garmol D, Palucki J, Zolciak-Siwinska A, Guzel-Szczepiorkowska Z, Pietrzak L, Komosinska K, Sprawka A, Garbaczewska A: Deli...

Ngày tải lên: 09/08/2014, 09:21

24 376 0
báo cáo khoa học: "Safety in home care: A research protocol for studying medication management" pdf

báo cáo khoa học: "Safety in home care: A research protocol for studying medication management" pdf

... collaborators from the project's inception, including provincial health minis- tries, national health information, patient safety, and accreditation bodies, and provincial and federal funding partners ... tex- tual data; understanding and comparing across several sources of data, synthesizing the data to capture mean- ings, constructing theoretical relationships from the data, and explai...

Ngày tải lên: 10/08/2014, 10:23

9 306 0
Báo cáo khoa hoc:" Pregnancy in dialysis patients: a case series" ppt

Báo cáo khoa hoc:" Pregnancy in dialysis patients: a case series" ppt

... Sabry Address: Prince Salman Center for Kidney Diseases, Riyadh, Kingdom of Saudi Arabia Email: Khalid A Al-Saran* - khalid_aln@yahoo.co.uk; Alaa A Sabry - asabry20@yahoo.com * Corresponding author ... Central Page 1 of 4 (page number not for citation purposes) Journal of Medical Case Reports Open Access Case report Pregnancy in dialysis patients: a case series Khalid A Al-Saran* an...

Ngày tải lên: 11/08/2014, 10:23

4 455 0
báo cáo khoa học:" Polyp in concha bullosa: a case report and review of the literature" pot

báo cáo khoa học:" Polyp in concha bullosa: a case report and review of the literature" pot

... content details. All authors read and approved the final manuscript. References 1. Yanagisawa E: Concha bullosa polyp. In Atlas of Rhinoscopy: Endo- scopic Sinonasal Anatomy and Pathology Ch ... Edited by: Yanagisawa E. San Diego, Singular- Thompson Learning; 2000. 2. Mirante JP, Christmas DA, Yanagisawa E: Polyps arising in a con- cha bullosa of the middle turbinate. Ear Nose Throat J...

Ngày tải lên: 11/08/2014, 23:22

3 386 0
báo cáo hóa học: " Bicarbonate in diabetic ketoacidosis - a systematic review" pptx

báo cáo hóa học: " Bicarbonate in diabetic ketoacidosis - a systematic review" pptx

... ketonemia, including a slower decline in ketonemia in the first hour of bicarbonate infusion in a RCT [13], and an increase in plasma acetoacetate levels during the initial three hours of bicarbo nate ... the administration of * Correspondence: Rinaldo.BELLOMO@austin.org.au 1 Department of Intensive Care, Austin Health, Melbourne, Victoria, Australia Full list of author informatio...

Ngày tải lên: 21/06/2014, 02:20

12 447 0
báo cáo khoa học: "Diverticulitis complicated by pylephlebitis: a case report" ppsx

báo cáo khoa học: "Diverticulitis complicated by pylephlebitis: a case report" ppsx

... cytosis and elevated alkaline phosphatase. A computed tomography scan revealed portal vein thrombosis and a sigmoid diverticulitis with an abscess. Our patient was given pipercillin-tozabactam followed ... improved clinically and was discharged home on ertapenem and enoxaparin. A follow-up computed tomography scan two weeks later showed a new pelvic abscess that was drained by a pig...

Ngày tải lên: 10/08/2014, 23:20

4 379 0
báo cáo khoa học: " Two-stimuli manipulation of a biological motor" ppsx

báo cáo khoa học: " Two-stimuli manipulation of a biological motor" ppsx

... myosin, kinesin and dynein move in linear fashion. Other motors perform rotary motion, e.g. the bacterial flagellar motor or the enzyme F 1 -ATPase. F 1 -ATPase hydrolyses ATP into ADP and inorganic ... Assay F 1 -ATPase was biotinylated at a single cysteine residue in subunit γ using biotin-(PEAC)5-maleimide (Dojindo, Japan), as described elsewhere [10]. The biotinylated F 1 - ATPase (...

Ngày tải lên: 11/08/2014, 00:22

4 281 0
báo cáo khoa học: "Changes in the distribution of the genetic variance of a quantitative trait in small populations of Drosophila melanogaster" docx

báo cáo khoa học: "Changes in the distribution of the genetic variance of a quantitative trait in small populations of Drosophila melanogaster" docx

... within-line genetic covariance will decrease as (1 - FJ cov A, cov A being the genetic covariance in the base population, and its variance will increase also towards an asymptotic ... variance within lines will also change. Its mean will decrease with time as (1 - FJ VA, while its variance will increase and rapidly approa- ch an asymptotic...

Ngày tải lên: 09/08/2014, 22:22

10 370 0
w