Báo cáo y học: "Psychogenic or neurogenic origin of agrammatism and foreign accent syndrome in a bipolar patient: a case report" pdf
Báo cáo y học: "Psychogenic or neurogenic origin of agrammatism and foreign accent syndrome in a bipolar patient: a case report" pdf
... CentralPage 1 of 7(page number not for citation purposes)Annals of General PsychiatryOpen Access Case reportPsychogenic or neurogenic origin of agrammatism and foreign accent syndrome in a bipolar ... agrammatism, initially categorized as being of psychogenic origin. The patient had an extensive neuropsychological and language evaluation aswell as brain imaging exams. In addition to FAS and ... language disorders characterized by a foreign accent and agrammatism initially categorized as being of psychogenic origin. Psychiatric patients do not commonlymanifest speech or language disorders...
- 7
- 502
- 0
Báo cáo y học: " Inhibition or knock out of Inducible nitric oxide synthase result in resistance to bleomycin-induced lung injury" potx
... Ikezaki S, Nishikawa A, Enami T, Furukawa F, Imazawa T, Uneyama C,Fukushima S, TakahASHI M: Inhibitory effects of the dietary anti-oxidants butylated hydroxyanisole and butylated hydroxy-toluene ... minimal. Moreo-ver it has a wide range of other effects, inhibitingadvanced glycosylation end-product formation, diamineoxidase and polyamine metabolism [59,60], catalase [61] and having anti-oxidant ... [26].Induction of lung injury by bleomycinMice received a single intratracheal instillation of saline(0.9%) or saline containing bleomycin sulphate (1 mg/kgbody weight) in a volume of 50 µl and were...
- 17
- 290
- 0
Báo cáo y học: "Single ventricle with persistent truncus arteriosus as two rare entities in an adult patient: a case report" doc
... Type A3 : a single pulmonary artery originating from thearterial trunk, along with collaterals originating from thedescending aorta.4. Type A4 : significant abnormalities of the aortic arch in association ... have some degree of hypoxemia caused byintracardiac shunting. Clinical manifestations are usuallyapparent shortly after birth. The most common findingsare dyspnea, tachycardia, cyanosis, and ... heartfailure. Later, secondary erythrocytosis and clubbing areusually present.The diagnosis may be defined by echocardiography, car-diac catheterization, and cardiac magnetic resonanceimaging....
- 6
- 277
- 0
Báo cáo y học: " Invasive versus noninvasive measurement of allergic and cholinergic airway responsiveness in mice" doc
... manuscript. JMH and NK participated in the coordination and analysis of the study. HGH conceived of the study, and participated in its design and analysis. All authors read and approvedthe final manuscriptAcknowledgementsWe ... reversible air-way obstruction of variable degree, airway inflammation,airway hyperresponsiveness (AHR) and airway remode-ling. These hallmarks of asthma are being examined in murine models, ... Example of an early airway response (EAR) to inhaled A. fumigatus 2 % in an orotracheally intu-bated allergic mouse. Decreases in GL, Cdyn, and EF50 values were associated with small declines in...
- 10
- 324
- 0
Báo cáo y học: "What is the role of surfactant and inhaled nitric oxide in lung transplantation" pps
... an increased small aggregate/large aggregate ratio in lavage of transplanted lungs. This finding led to thehypothesis that leakage of plasma protein into the alveolarspace may inhibit surface-active ... initially impaired graft functionafter lung transplantation, and do these findings apply toother forms of lung injury?Ischaemia/reperfusion injury leading to initial graft failure is a major cause ... reperfusion injury after lung transplantation and successful treatment using a combination of inhaled nitricoxide (iNO) and surfactant instillation. What is the role of surfactant in management of initially...
- 3
- 407
- 0
Báo cáo y học: "α Does protein kinase R mediate TNF-α- and ceramide-induced increases in expression and activation of matrix metalloproteinases in articular cartilage by a novel mechanism" pps
... complementary DNA-array technology. Arthritis Rheum 2001, 44:2777-2789.3. Yoshihara Y, Nakamura H, Obata K, Yamada H, Hayakawa T,Fujikawa K, Okada Y: Matrix metalloproteinases and tissueinhibitors ... (MMP)expression and activation in the medium were analysed bygelatin zymography, proteoglycan release by thedimethylmethylene blue assay, and cell viability by theCytotox 96®assay. C2-ceramide treatment ... presence or absence of 2-AP (10 mM) and analysed by gelatin substrate zymography.The area (absorbance units) of substrate gel cleared by proMMP-9 and active MMP-9 was measured by scanning densitometry....
- 10
- 379
- 0
Báo cáo y học: "β Treatment with recombinant interferon-β reduces inflammation and slows cartilage destruction in the collagen-induced arthritis model of rheumatoid arthritis" ppt
... volunteers. J Interferon Cytokine Res 2000, 20:857-866.28. Miyazaki T, Katagiri H, Kanegae Y, Takayanagi H, Sawada Y, Yamamoto A, Pando MP, Asano T, Verma IM, Oda H, NakamuraK, Tanaka S: Reciprocal role ... survival, and /or retention in the synovial joint.Alternatively, IFN-β may inhibit inflammatory cell infiltrationindirectly, via suppression of FLS and /or monocyteactivation. Our data demonstrated ... demonstrated statistically significantmodulation of proinflammatory and anti-inflammatory cyto-kine production in animals treated with IFN-β. We found a statistically significant reduction of TNF-α and...
- 11
- 345
- 0
Báo cáo y học: "Relationship between radiographic grading of osteoarthritis and the biochemical markers for arthritis in knee osteoarthritis" doc
... between radiographic grading of osteoarthritis and the biochemical markers for arthritis in knee osteoarthritisMasaaki Takahashi, Kenichi Naito, Masashi Abe, Tomokazu Sawada and Akira NaganoDepartment ... immunoassay kits (Fuji ChemicalIndustries, Toyama, Japan) [9]. The intra-assay and interassay variations in MMP-3, MMP-9 and TIMP-1 wereless than 8.9%.Statistical analysisThe statistical significance ... pyridinoline were corrected by urinarycreatinine. The intra-assay and interassay coefficients of variance were 6.4% and 5.9%, respectively.Serum YKL-40Serum YKL-40 was measured with an enzyme-linkedimmunosorbent...
- 5
- 449
- 0
Báo cáo y học: "Catabolic stress induces expression of hypoxia-inducible factor (HIF)-1α in articular chondrocytes: involvement of HIF-1α in the pathogenesis of osteoarthritis" ppt
... CACACCATCTTCTGGTGTACAGTCTHIF-1α fw:CTATGGAGGCCAGAAGAGGGTAT AGATCCCTTGAAGCTAG-MGBrv:CCCACATCAGGTGGCTCATAAGlucose transporter-1 fw:GGGCATGTGCTTCCAGTATGT CAACTGTGCGGCCCCTACGTCTTCrv:ACGAGGAGCACCGTGAAGATfw, ... x-ray film of knee joint and safranin-O stain-ing for hypoxia-inducible factor 1α(HIF-1α) in the degenerated region and intact region of articular cartilage from a 66-year-old woman with OA. Original ... factors or act as a chondroprotective factor to maintain chondrocyte via-bility in the face of catabolic changes in articular cartilage.Many molecular aspects of HIF-1 signaling should be alsostudied...
- 11
- 385
- 0
Báo cáo y học: "Novel therapies for treatment of gout and hyperuricemia" pot
... therapy in pediatrictumor lysis syndrome. Unfortunately, rasburicase is bothhighly antigenic and has a plasma half-life of 18 to 24 hours[52]. Efficacy, tolerability, and sustainability of rasburicasetreatment ... thenormal abundance of catalase on erythrocytes [51,59,60] and potentially by other plasma antioxidant defenses. Yetmethemoglobinemia and /or hemolysis have been unequivocalindicators of uricase-induced ... that approximately half of febuxostat-treated patients with tophi can achieve elimination of tophi by 2 years, and approximately 70% by 5 years [49].Quality of life parameters have been favorably...
- 11
- 418
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDETrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ