Báo cáo y học: "Psychogenic or neurogenic origin of agrammatism and foreign accent syndrome in a bipolar patient: a case report" pdf
Báo cáo y học: "Psychogenic or neurogenic origin of agrammatism and foreign accent syndrome in a bipolar patient: a case report" pdf
... Central Page 1 of 7 (page number not for citation purposes) Annals of General Psychiatry Open Access Case report Psychogenic or neurogenic origin of agrammatism and foreign accent syndrome in a bipolar ... agrammatism, initially categorized as being of psychogenic origin. The patient had an extensive neuropsychological and language evaluation as well as bra...
Ngày tải lên: 08/08/2014, 21:20
Báo cáo y học: " Inhibition or knock out of Inducible nitric oxide synthase result in resistance to bleomycin-induced lung injury" potx
... Ikezaki S, Nishikawa A, Enami T, Furukawa F, Imazawa T, Uneyama C, Fukushima S, TakahASHI M: Inhibitory effects of the dietary anti- oxidants butylated hydroxyanisole and butylated hydroxy- toluene ... minimal. Moreo- ver it has a wide range of other effects, inhibiting advanced glycosylation end-product formation, diamine oxidase and polyamine metabolism [59,60], catalase [61] an...
Ngày tải lên: 12/08/2014, 18:21
Báo cáo y học: "Single ventricle with persistent truncus arteriosus as two rare entities in an adult patient: a case report" doc
... Type A3 : a single pulmonary artery originating from the arterial trunk, along with collaterals originating from the descending aorta. 4. Type A4 : significant abnormalities of the aortic arch in association ... have some degree of hypoxemia caused by intracardiac shunting. Clinical manifestations are usually apparent shortly after birth. The most common findings are dyspnea, tachyc...
Ngày tải lên: 11/08/2014, 23:21
Báo cáo y học: " Invasive versus noninvasive measurement of allergic and cholinergic airway responsiveness in mice" doc
... manuscript. JMH and NK participated in the coordination and analysis of the study. HGH conceived of the study, and participated in its design and analysis. All authors read and approved the final manuscript Acknowledgements We ... reversible air- way obstruction of variable degree, airway inflammation, airway hyperresponsiveness (AHR) and airway remode- ling. These hallm...
Ngày tải lên: 12/08/2014, 18:20
Báo cáo y học: "What is the role of surfactant and inhaled nitric oxide in lung transplantation" pps
... an increased small aggregate/large aggregate ratio in lavage of transplanted lungs. This finding led to the hypothesis that leakage of plasma protein into the alveolar space may inhibit surface-active ... initially impaired graft function after lung transplantation, and do these findings apply to other forms of lung injury? Ischaemia/reperfusion injury leading to initial graft failu...
Ngày tải lên: 12/08/2014, 18:21
Báo cáo y học: "α Does protein kinase R mediate TNF-α- and ceramide-induced increases in expression and activation of matrix metalloproteinases in articular cartilage by a novel mechanism" pps
... complementary DNA- array technology. Arthritis Rheum 2001, 44:2777-2789. 3. Yoshihara Y, Nakamura H, Obata K, Yamada H, Hayakawa T, Fujikawa K, Okada Y: Matrix metalloproteinases and tissue inhibitors ... (MMP) expression and activation in the medium were analysed by gelatin zymography, proteoglycan release by the dimethylmethylene blue assay, and cell viability by the Cytotox 96 ®...
Ngày tải lên: 09/08/2014, 01:23
Báo cáo y học: "β Treatment with recombinant interferon-β reduces inflammation and slows cartilage destruction in the collagen-induced arthritis model of rheumatoid arthritis" ppt
... volunteers. J Interferon Cytokine Res 2000, 20:857- 866. 28. Miyazaki T, Katagiri H, Kanegae Y, Takayanagi H, Sawada Y, Yamamoto A, Pando MP, Asano T, Verma IM, Oda H, Nakamura K, Tanaka S: Reciprocal role ... survival, and /or retention in the synovial joint. Alternatively, IFN-β may inhibit inflammatory cell infiltration indirectly, via suppression of FLS and /or monocyte acti...
Ngày tải lên: 09/08/2014, 01:23
Báo cáo y học: "Relationship between radiographic grading of osteoarthritis and the biochemical markers for arthritis in knee osteoarthritis" doc
... between radiographic grading of osteoarthritis and the biochemical markers for arthritis in knee osteoarthritis Masaaki Takahashi, Kenichi Naito, Masashi Abe, Tomokazu Sawada and Akira Nagano Department ... immunoassay kits (Fuji Chemical Industries, Toyama, Japan) [9]. The intra-assay and interassay variations in MMP-3, MMP-9 and TIMP-1 were less than 8.9%. Statistical analysis...
Ngày tải lên: 09/08/2014, 01:23
Báo cáo y học: "Catabolic stress induces expression of hypoxia-inducible factor (HIF)-1α in articular chondrocytes: involvement of HIF-1α in the pathogenesis of osteoarthritis" ppt
... CACACCATCTTCTGGTGTACAGTCT HIF-1α fw:CTATGGAGGCCAGAAGAGGGTAT AGATCCCTTGAAGCTAG-MGB rv:CCCACATCAGGTGGCTCATAA Glucose transporter-1 fw:GGGCATGTGCTTCCAGTATGT CAACTGTGCGGCCCCTACGTCTTC rv:ACGAGGAGCACCGTGAAGAT fw, ... x-ray film of knee joint and safranin-O stain- ing for hypoxia-inducible factor 1α(HIF-1α) in the degenerated region and intact region of articular cartilage from a 66-year...
Ngày tải lên: 09/08/2014, 06:23
Báo cáo y học: "Novel therapies for treatment of gout and hyperuricemia" pot
... therapy in pediatric tumor lysis syndrome. Unfortunately, rasburicase is both highly antigenic and has a plasma half-life of 18 to 24 hours [52]. Efficacy, tolerability, and sustainability of rasburicase treatment ... the normal abundance of catalase on erythrocytes [51,59,60] and potentially by other plasma antioxidant defenses. Yet methemoglobinemia and /or hemolysis hav...
Ngày tải lên: 09/08/2014, 14:21