Báo cáo y học: "Binge eating symptomatology in overweight and obese patients with schizophrenia: a case control study" ppt
Báo cáo y học: "Binge eating symptomatology in overweight and obese patients with schizophrenia: a case control study" ppt
... suggest that binge eating symptomatology may play an important role in the initi- ation and maintenance of the WG phenomenon observed in at least part of patients with schizophrenia. Finally, management ... of binge eating symptomatology in patients treated with clozapine and olanzapine. J Neural Transm 2003, 110:111-121. 4. Aquila R, Emanuel M: Interventions for Wei...
Ngày tải lên: 08/08/2014, 21:20
Báo cáo y học: "Osteogenic protein 1 in synovial fluid from patients with rheumatoid arthritis or osteoarthritis: relationship with disease and levels of hyaluronan and antigenic keratan sulfate" ppt
... Standard of keratan sulfate purified from human costal cartilage [20]. The intra-assay variation was <3%, and the inter-assay variation was <4%. Measurement of HA by ELISA Hyaluronan in ... nonkeratan-sulfate-contain- ing rat chondrosarcoma proteoglycans that capture HA and the keratan-sulfate-bearing aggregating proteoglycans that are subsequently added. The assay produces very s...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: "DREAM is reduced in synovial fibroblasts of patients with chronic arthritic pain: is it a suitable target for peripheral pain management" pptx
... 5'-AAGTGGGCCTTTAATCTCTACTATAGTGAGTCGTATTA-3' siRNA4 5'-AAGCTCATGATGTTCTCATCCTATAGTGAGTCGTATTA-3' 5'-AAGGATGAGAACATCATGAGCTATAGTGAGTCGTATTA-3' siRNA5 5'-AAGTGTAGCAATCTGTTCACTATAGTGAGTCGTATTA-3' ... 5'AAGGTCAAGTGGATCCTGTCCTATAGTGAGTCGTATTA3' siRNA2 5'-AAGGTGAACTTGGTCTGGGCCTATAGTGAGTCGTATTA3' 5'-AAGGCCCAGACCAAGTTCACCTATAGTGAGTCGTAT...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: ": Gastrointestinal relapse of multiple myeloma and sustained response to lenalidomide: a case repo" pps
... by a North American Institution involved the gastrointestinal tract [3]. All of these cases had a poor prognosis, with a maximal survival rate of 106 days from diagnosis. Finally, Dawson et al. ... from TAM and PYD. TAM and XM reviewed and interpreted the pathology slides and CT scan images, respectively. All authors read and approved the final manuscript. Competing interest...
Ngày tải lên: 11/08/2014, 00:23
Báo cáo y học: "Hepatotoxicity induced by horse ATG and reversed by rabbit ATG: a case report" ppsx
... M, Kishimoto Y, Nakai K, Shimizu T, Matsumoto N, Miyazaki Y, Yamamoto Y, Amakawa R, Fujimoto M, Fukuhara S: Antithymo- cyte globulin treatment in 11 patients with aplastic anaemia. Rinsho Ketsueki ... received androgen therapy. After finding a healthy and an HLA identical sibling donor, the patient was transferred to King Faisal Specialist Hospital and Research Centre (KFSH&...
Ngày tải lên: 11/08/2014, 10:22
Báo cáo y học: " Primary hepatic lymphoma presenting as fulminant hepatic failure with hyperferritinemia: a case report" ppt
... hepatitis B, C and Epstein-Barr have been implicated. Signs and symptoms can mimic a variety of infectious and inflammatory disorders delaying the diag- nosis. A preliminary diagnosis of AOSD was ... weight loss, myalgias and arthralgias. She had mild epigastric dis- comfort with nausea and vomiting. Dalteparin and warfa- rin were started for a recently diagnosed pulmonary...
Ngày tải lên: 11/08/2014, 21:22
Báo cáo y học: "Thioglycosides as inhibitors of hSGLT1 and hSGLT2: Potential therapeutic agents for the control of hyperglycemia in diabetes"
... Germany; 2. Max Planck Institute for Chemical Ecology, Dortmund, Germany Correspondence to: Francisco Castaneda, MD, Laboratory for Molecular Pathobiochemistry and Clinical Research, Max Planck ... Na+-glucose cotransporters, on metabolic index and insulin secretion in spontaneously diabetic GK rats. Clinical and Experimental Pharmacology and Physiol- ogy. 2002; 29: 386-390. 18...
Ngày tải lên: 26/10/2012, 10:04
Báo cáo y học: "Association of Adiposity, Cardiorespiratory Fitness and Exercise Practice with the Prevalence of Type 2 Diabetes in Brazilian Elderly Women" pot
... 29]. Health professionals should encourage individuals of all ages to maintain an active life-style that can attenuate the negative physiologic changes that accompany advancing age, leading to ... Tratado de Geriatria e Gerontologia. Guanabara Koogan, 2002:496-501. 5. Kanaya AM, Harris T, Goodpaster BH, Tylavsky F, Cummings SR. Adipocytokines Attenuate the Association Between Visceral...
Ngày tải lên: 08/08/2014, 16:23
Báo cáo y học: "Hormone replacement therapy in rheumatoid arthritis is associated with lower serum levels of soluble IL-6 receptor and higher insulin-like growth factor 1" doc
... after 12 and 24 months, using vaginal ultrasonography and cytology. E 2 in serum was measured (approximately 12 hours after tablet intake) by radioimmunoassay (Clinical AssaysTM, DiaSorin, Vercelli, ... Kameda T, Mano H, Yuasa T, Mori Y, Miyazawa K, Shiokawa M, Nakamaru Y, Hiroi E, Hiura K, Kameda A, Yang NN, Hakeda Y, Kumegawa M: Estrogen inhibits bone resorption by directly induc...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: "High CXCR3 expression in synovial mast cells associated with CXCL9 and CXCL10 expression in inflammatory synovial tissues of patients with rheumatoid arthritis" potx
... annealing temperature. The primer pairs 5′-TGG GCA ACA ATA CAG CAA ACT-3′ and 5′-GAG CAG GAA GAT GAG GAC GAC-3′, at 58°C annealing temperature and for 33 cycles, were used for CXCR2-specific amplification; ... to synovial fibroblasts, identified by an antibody against prolyl-4-hydroxylase (data not shown). In 10 OA samples examined, there was stain- ing for CXCR1 protein on a few macr...
Ngày tải lên: 09/08/2014, 01:23