Báo cáo y học: "The nosological significance of Folie à Deux: a review of the literature" doc

Báo cáo y học: "Elevated plasma homocysteine is positively associated with age independent of C677T mutation of the methylenetetrahydrofolate reductase gene in selected Egyptian subjects"

Báo cáo y học: "Elevated plasma homocysteine is positively associated with age independent of C677T mutation of the methylenetetrahydrofolate reductase gene in selected Egyptian subjects"

... were transformed logarithmically to approximate normal distribution, and such data were analysed statistically. Statistical analysis of the data analysis was carried out using the ANOVA test. ... Mukawa H, Tomida T, Suzuki T, Kamiya H, Matsui H, Hayakawa T. Relation of a common methylenetetrahydrofolate reductase mutation and plasma homocysteine with intimal hyperplasia after...

Ngày tải lên: 03/11/2012, 09:49

12 519 0
Báo cáo Y học: Amino acids 3–13 and amino acids in and flanking the 23FxxLF27 motif modulate the interaction between the N-terminal and ligand-binding domain of the androgen receptor pdf

Báo cáo Y học: Amino acids 3–13 and amino acids in and flanking the 23FxxLF27 motif modulate the interaction between the N-terminal and ligand-binding domain of the androgen receptor pdf

... between both assays is the coupling of AR.NTD to GalAD in the yeast assay, and the absence of a second transactivation domain linked to AR NTD in the mammalian assay. The latter assay completely depends ... 5¢- AATTCGGGGCCCGGGTTCTGGATCACTTCGCGCACGCTCTGGAACAGATTCTG-3¢ pr172B 5¢- CGGAGCAGCTGCTTAAGCCGGGG-3¢ pr-242 5¢- AAGCTTCTGCAGGTCGACTCTAGG-3¢ PDsense 5¢- GATCCATATCGATAAGCTTAGA...

Ngày tải lên: 17/03/2014, 10:20

12 597 0
Báo cáo Y học: Guanosine diphosphate-4-keto-6-deoxy-D-mannose reductase in the pathway for the synthesis of GDP-6-deoxy-D-talose in Actinobacillus actinomycetemcomitans potx

Báo cáo Y học: Guanosine diphosphate-4-keto-6-deoxy-D-mannose reductase in the pathway for the synthesis of GDP-6-deoxy-D-talose in Actinobacillus actinomycetemcomitans potx

... broad range of bacterial species. The polysaccharides often constitute the outermost layer of the cell, and have been implicated as an important factor in the virulence of many animal and plant ... Faculty of Dental Science, Fukuoka, Japan; 3 Department of Oral Health, Nihon University School of Dentistry, Tokyo, Japan The serotype a- specific polysaccharide antigen of...

Ngày tải lên: 17/03/2014, 10:20

9 626 0
Báo cáo Y học: Brassica napus soluble epoxide hydrolase (BNSEH1) Cloning and characterization of the recombinant enzyme expressed in Pichia pastoris docx

Báo cáo Y học: Brassica napus soluble epoxide hydrolase (BNSEH1) Cloning and characterization of the recombinant enzyme expressed in Pichia pastoris docx

... all subsequent analysis. The sEH activity in the cells increased rapidly after addition of methanol and cells were usually harvested after four days of culture. After several passages of the yeast cells ... and assayed for enzyme activity and absorbance at 280 nm. Catalytic characterization of recombinant BNSEH1 Epoxide hydrolase activity was assayed based on conversion of [ 3...

Ngày tải lên: 31/03/2014, 08:20

8 408 0
Báo cáo Y học: Conformationally constrained human calcitonin (hCt) analogues reveal a critical role of sequence 17–21 for the oligomerization state and bioactivity of hCt ppt

Báo cáo Y học: Conformationally constrained human calcitonin (hCt) analogues reveal a critical role of sequence 17–21 for the oligomerization state and bioactivity of hCt ppt

... & Saudek, V. (1991) Solution structure of salmon calcitonin. Biopolymers 31, 233–241. 18. K atahira, R., Doi, M., Kyogoku, Y. , Yamada-Nosaka, A. , Yamasaki, K., Takai, M. & Kobayashi, Y. ... small changes of these residues may dramatically affect the type a nd stability o f the turn [34,35]. To investigate the importance of t he type of the postulated turn for hC...

Ngày tải lên: 31/03/2014, 21:21

12 448 0
Báo cáo y học: "Self-reported asthma and allergies in top athletes compared to the general population - results of the German part of the GA2LEN-Olympic study 2008" pptx

Báo cáo y học: "Self-reported asthma and allergies in top athletes compared to the general population - results of the German part of the GA2LEN-Olympic study 2008" pptx

... your chest at any time in the last 12 months? ▪ Docto r’sdiagnosedasthma: Have you ever had asthma? AND Was this confirmed by a doctor? ▪ Current use of asthma medication: Are you cur- rently ... some insights in the quality of asthma s urveillance in athletes and non-athletes. Methods Study design and participants Within the framework of the Global Asthma and Allergy European...

Ngày tải lên: 08/08/2014, 21:20

6 467 0
Báo cáo y học: "Electronic patient record use during ward rounds: a qualitative study of interaction between medical staff"

Báo cáo y học: "Electronic patient record use during ward rounds: a qualitative study of interaction between medical staff"

... ward-round team became aware of the lack of inter- action when using the EPR – a change of formation to allow focus on the conversation rather than the data, as described above, and the use of paper ... that the physical setup of the EPR, by giving unequal access to the patient's data as well as the consultant's reaction to the data, can lead to decre...

Ngày tải lên: 25/10/2012, 10:31

8 503 0
Báo cáo y học: "Percutaneous laser disc decompression for thoracic disc disease: report of 10 cases"

Báo cáo y học: "Percutaneous laser disc decompression for thoracic disc disease: report of 10 cases"

... present. All the patients had neg- ative facet injections, to evaluate for the possibility of facet joint pain as the underlying cause. The patients had positive discograms that correlated to their ... estab- lished accuracy of discography, we required the combination of an abnormal MRI and a positive pro- vocative discogram to diagnose intervertebral discs as the sourc...

Ngày tải lên: 26/10/2012, 09:07

5 593 0
Báo cáo y học: "Parvovirus B19 Genotype Specific Amino Acid Substitution in NS1 Reduces the Protein’s Cytotoxicity in Culture"

Báo cáo y học: "Parvovirus B19 Genotype Specific Amino Acid Substitution in NS1 Reduces the Protein’s Cytotoxicity in Culture"

... External Primers F- 5’ GGCGACGAATTCATGGAGCTATTTAG GG R- 5’ GGCCATCTAGATTACTCATAATCTACAAAGCT PathT - PRMTTA 1- 5’ AGTATCATTTATGGCTACGGTAATG 2- 5’ ATTACCGTAGCCATAAATGATACTAGTAG ... University of Jyväskylä, Jyväskylä, Fin- land; 3. Quest Diagnostics Nichols Institute, San Juan Capistrano, CA, U.S .A.  Corresponding author: Stanley J. Naides, M.D., Mail: 33608 Ortega...

Ngày tải lên: 26/10/2012, 09:32

10 554 0
Tài liệu Báo cáo Y học: Dnmt3a and Dnmt1 functionally cooperate during de novo methylation of DNA pdf

Tài liệu Báo cáo Y học: Dnmt3a and Dnmt1 functionally cooperate during de novo methylation of DNA pdf

... interaction of the catalytic domain with the N-terminal part of the enzyme leading to an allosteric activation of the enzyme after binding to methylated DNA. J. Mol. Biol. 309, 1189–1199. 19. Bacolla, A. , ... methylation catalyzed by Dnmt1 and the second one very fast. Therefore, this effect can only double the rate of DNA methylation, because every turnover by Dnmt 3a...

Ngày tải lên: 21/02/2014, 01:21

4 526 0
Từ khóa:
w