Báo cáo y học: "Assessment of epicutaneous testing of a monovalent Influenza A (H1N1) 2009 vaccine in egg allergic patients" potx

... 2010, 126:317-23. doi:10.1186/1710-1492-7-3 Cite this article as: Pitt et al.: Assessment of epicutaneous testing of a monovalent Influenza A (H1N1) 2009 vaccine in egg allergic patients. Allergy, Asthma & Clinical Immunology 2011 7:3. Submit ... this virus. Patients with IgE mediated allergy to egg have in the past been advised to avoid the influenza...

Ngày tải lên: 08/08/2014, 21:20

... GGGGACGAGAGACAGAGACA GagOR CAGAGGAGGAAGGTTGTGCT XGagP2 ACCTTGCAGCACTGGGGAGATGTC Probe gag2 Forward AGGTAGGAACCACCTAGTYC 1581 to 1764 RNA from 62 μL plasma RT-PCR using AgPath-ID one step RT-PCR kit (Applied Biosystems) ... amount of starting DNA. Specifically, the assays of Lo et al. and Lombardi et al. can at best detect 1 copy of XMRV/MuLV in a background of 30 to 50 ng and 100...

Ngày tải lên: 13/08/2014, 01:20

... Microscopy & Microanalysis Research Facility) at the Australian Centre for Microscopy & Microanalysis, The University of Sydney. Author details 1 Faculty of Pharmacy, University of Sydney, ... with central veins at each tip surrounding a portal triad) and Rappaport’s liver acinus (adjacent triangular acini share a common base and comprise a diamond with central veins at th...

Ngày tải lên: 13/08/2014, 13:20

... VE varied according to the order of the attending physician and included normal saline, Ringer's lactate and het- astarch. The volume administered in each case was at least 500 ml, and was ... data acquisition, par- ticipated in drafting the manuscript, and performed statistical analysis. WI had full access to all of the data in the study and takes responsibility for the integr...

Ngày tải lên: 25/10/2012, 10:06

... olyDoms database, which inte- grates all coding SNPs in human protein domains. Database construction The CMSNP database contains two main datasets, an SNP dataset and an SV dataset, which are ... regions. All data have been organized into a MySQL relational database, which is efficient in retrieving data from indexed files. The CMSNP database is loaded in large batches and used primar...

Ngày tải lên: 09/08/2014, 23:20

... Veterinary Products Institutional Animal Care and Use Committee. Clinical signs (sneezing, nasal discharg e and coughing) and rectal temperatures were recorded daily for 14 days post-inoculation ... Jung 6 , Minjoo Yeom 2 , Hyekwon Kim 3 , Sangyoon Han 2 , Dongjun An 4 , Jinsik Oh 5 , Jongman Kim 2 , Bongkyun Park 3 , Bokyu Kang 2* Abstract Background: Avian origin canine influenza virus wa...

Ngày tải lên: 11/08/2014, 21:21

... XS, Jiang B, Li M, Xin W, Zhao BL: Chinonin, a novel drug against cardiomyocyte apoptosis induced by hypoxia and reoxygenation. Biochim Biophys Acta 2000, 1500:217-226. 17. Araya R, Uehara T, ... hypoxia-reoxygenated cardiomyocytes. Cytochrome c was detected by Western blot analysis using a monoclonal antibody against cytochrome c. Anti-actin antibody was used as internal control. (A) eff...

Ngày tải lên: 13/08/2014, 14:20

... Following a cognitive behavioral-based approach, therapists can take advantage of interactivity and flexibility offered by virtual environments to measure and monitor a wide variety of patients' ... STAI-S = Stait Anxiety Inventory; VAS -A = Visual Analogue Scale for anxiety. Gorini et al. Annals of General Psychiatry 2010, 9:30 http://www.annals-general-psychiatry.com/content...

Ngày tải lên: 08/08/2014, 23:21

... follow-up, pairs of base- line and 2-year radiographs were available for 186 patients. Primary analysis set The primary analysis set contained all patients in the OASIS and adalimumab-treated cohorts ... set was compared with the adalimumab cohort in a separate analysis. Assessment of radiographic progression Baseline and 2-year radiographs of the lateral cervical and lumbar spine...

Ngày tải lên: 09/08/2014, 14:22

... prevent infection. A safe and simple assay for measuring neutralizing activi- ties against different HIV-1 strains is critical for the devel- opment of such a vaccine or entry inhibiting drugs. We ... with a variant of the HIV-1 envelope protein (Env) containing the surface glycopro- tein gp120-SU and a carboxyl-terminally truncated trans- membrane (TM) protein with only 7 cytop...

Ngày tải lên: 10/08/2014, 05:20