Báo cáo y học: "Food allergy management from the perspective of patients or caregivers, and allergists: a qualitative study" docx
Báo cáo y học: "Food allergy management from the perspective of patients or caregivers, and allergists: a qualitative study" docx
... 8:45.
doi:10.1186/1710-1492-6-30
Cite this article as: Xu et al.: Food allergy management from the
perspective of patients or caregivers, and allergists: a qualitative study.
Allergy, Asthma & Clinical Immunology 2010 6:30.
Submit ... allergy management from the perspective
of patients or caregivers, and allergists: a
qualitative study...
Báo cáo khoa học: Nitric oxide formation from the reaction of nitrite with carp and rabbit hemoglobin at intermediate oxygen saturations pdf
... oxygenated carp
Hb at 100% So
2
was clearly autocatalytic. The reac-
tion rate initially showed a sharp increase, reached a
marked peak and then displayed a decrease, as the
reaction approached ... T-state stabilization by ATP and the effects of
changes in O
2
tension ⁄ saturation during the reaction.
The data revealed that the reactivity is dynamically
influenced by ox...
Báo cáo y học: "In adult onset myositis, the presence of interstitial lung disease and myositis specific/associated antibodies are governed by HLA class II haplotype, rather than by myositis subtype" pdf
... O'Hanlon TP, Jara LJ, Samayoa
EA, Burgos-Vargas R, Vazquez-Mellado J, Alcocer-Varela J, Sala-
zar-Paramo M, et al.: Differences in idiopathic inflammatory
myopathy phenotypes and genotypes ... Horiki T, Ichikawa Y, Moriuchi J, Hoshina Y, Yamada C, Wakaba-
yashi T, Jackson K, Inoko H: HLA class II haplotypes associated
with pulmonary interstitial lesions of polymyositis/dermato-
myo...
Báo cáo y học: " New technical approach for the repair of an abdominal wall defect after a transverse rectus abdominis myocutaneous flap: a case report" pot
... resorbable suture material. An additional aug-
mentation was performed by the implantation of a
resorbable polyglactin mesh placed on the fascial suture.
The patient presented at the authors' ... disturbance, these defects can
also lead to adverse interference of the abdominal wall
functions, as a thrust bearing for the intraabdominal pres-
sure and as an antagonist...
Báo cáo y học: "DREAM is reduced in synovial fibroblasts of patients with chronic arthritic pain: is it a suitable target for peripheral pain management" pptx
... 5'-AAGTGGGCCTTTAATCTCTACTATAGTGAGTCGTATTA-3'
siRNA4 5'-AAGCTCATGATGTTCTCATCCTATAGTGAGTCGTATTA-3' 5'-AAGGATGAGAACATCATGAGCTATAGTGAGTCGTATTA-3'
siRNA5 5'-AAGTGTAGCAATCTGTTCACTATAGTGAGTCGTATTA-3' ... 5'AAGGTCAAGTGGATCCTGTCCTATAGTGAGTCGTATTA3'
siRNA2 5'-AAGGTGAACTTGGTCTGGGCCTATAGTGAGTCGTATTA3' 5'-AAGGCCCAGACCAAGTTCACCTATAGTGAGTCGTAT...
Báo cáo y học: "Histone tales: echoes from the past, prospects for the future" ppt
... paved
the way for these changes on a site-specific scale.
To test the hypothesis that dauer-induced chromatin
changes can act as a ‘pacemaker’ for changes in local
transcription, the authors ... their analysis to dauer, postdauer and
control larvae they could further show that the altered
gene expression observed in postdauer animals arises
from multiple regulatory mechanis...
Báo cáo y học: " Lateral rectus metastasis from an occult systemic malignancy masquerading as abducens palsy: a case report" pdf
... malignancies are com-
monly breast, prostate and lungs and less commonly gas-
trointestinal tract, kidney, skin (melanoma), thyroid,
liver, pancreas, adrenal and salivary glands and choroidal
melanoma [1-3].
The ... extraocular muscles can
present as isolated diplopia in the absence of a history of
systemic malignancy.
4. Local ophthalmic signs may be subtle or minimal in...
Báo cáo y học: "Endoscopic Facet Debridement for the treatment of facet arthritic pain – a novel new technique
... 40% of patients
had relief for at least 12 months, and mean duration of
pain relief was 14 months. Barlocher et al.
1
treated 50
patients with cryorhizotomy of the medial branch. At
1-year ... similar ef-
ficacy. In a study of 76 patients treated via CT-guided
cryorhizotomy of the dorsal nerve medial branch,
Staender et al.
17
reported a mean VAS pain score...
Báo cáo y học: "Godoy & Godoy technique in the treatment of lymphedema for under-privileged populations."
... and evaluate new therapeutic alternatives for
the treatment of lymphedema.
Godoy & Godoy’s novel approach to the
treatment of lymphedema
Over the last few years, Godoy & Godoy have ... of the limb. These exercises are
specific and require knowledge of the venous and
lymphatic anatomy and physiology.
Continuous guidance and evaluation of patients...
Báo cáo y học: " Vacuum-assisted closure in the treatment of early hip joint infection"
... contamination, usually leading to prosthesis
explantation [15].
Morykwas et al. have demonstrated that the ap-
plication of the V .A. C. – system increased the granu-
lation tissue formation and ... and lavage of the exposed prosthesis parts.
Moreover, we advance the view that an adequate
wound closure can only be performed after an exact
anatomical preparation and mo...