Báo cáo y học: "Food allergy management from the perspective of patients or caregivers, and allergists: a qualitative study" docx
... 8:45. doi:10.1186/1710-1492-6-30 Cite this article as: Xu et al.: Food allergy management from the perspective of patients or caregivers, and allergists: a qualitative study. Allergy, Asthma & Clinical Immunology 2010 6:30. Submit ... allergy management from the perspective of patients or caregivers, and allergists: a qualitative study...
Ngày tải lên: 08/08/2014, 21:20
... oxygenated carp Hb at 100% So 2 was clearly autocatalytic. The reac- tion rate initially showed a sharp increase, reached a marked peak and then displayed a decrease, as the reaction approached ... T-state stabilization by ATP and the effects of changes in O 2 tension ⁄ saturation during the reaction. The data revealed that the reactivity is dynamically influenced by ox...
Ngày tải lên: 16/03/2014, 06:20
... O'Hanlon TP, Jara LJ, Samayoa EA, Burgos-Vargas R, Vazquez-Mellado J, Alcocer-Varela J, Sala- zar-Paramo M, et al.: Differences in idiopathic inflammatory myopathy phenotypes and genotypes ... Horiki T, Ichikawa Y, Moriuchi J, Hoshina Y, Yamada C, Wakaba- yashi T, Jackson K, Inoko H: HLA class II haplotypes associated with pulmonary interstitial lesions of polymyositis/dermato- myo...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: " New technical approach for the repair of an abdominal wall defect after a transverse rectus abdominis myocutaneous flap: a case report" pot
... resorbable suture material. An additional aug- mentation was performed by the implantation of a resorbable polyglactin mesh placed on the fascial suture. The patient presented at the authors' ... disturbance, these defects can also lead to adverse interference of the abdominal wall functions, as a thrust bearing for the intraabdominal pres- sure and as an antagonist...
Ngày tải lên: 11/08/2014, 23:21
Báo cáo y học: "DREAM is reduced in synovial fibroblasts of patients with chronic arthritic pain: is it a suitable target for peripheral pain management" pptx
... 5'-AAGTGGGCCTTTAATCTCTACTATAGTGAGTCGTATTA-3' siRNA4 5'-AAGCTCATGATGTTCTCATCCTATAGTGAGTCGTATTA-3' 5'-AAGGATGAGAACATCATGAGCTATAGTGAGTCGTATTA-3' siRNA5 5'-AAGTGTAGCAATCTGTTCACTATAGTGAGTCGTATTA-3' ... 5'AAGGTCAAGTGGATCCTGTCCTATAGTGAGTCGTATTA3' siRNA2 5'-AAGGTGAACTTGGTCTGGGCCTATAGTGAGTCGTATTA3' 5'-AAGGCCCAGACCAAGTTCACCTATAGTGAGTCGTAT...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: "Histone tales: echoes from the past, prospects for the future" ppt
... paved the way for these changes on a site-specific scale. To test the hypothesis that dauer-induced chromatin changes can act as a ‘pacemaker’ for changes in local transcription, the authors ... their analysis to dauer, postdauer and control larvae they could further show that the altered gene expression observed in postdauer animals arises from multiple regulatory mechanis...
Ngày tải lên: 09/08/2014, 20:21
Báo cáo y học: " Lateral rectus metastasis from an occult systemic malignancy masquerading as abducens palsy: a case report" pdf
... malignancies are com- monly breast, prostate and lungs and less commonly gas- trointestinal tract, kidney, skin (melanoma), thyroid, liver, pancreas, adrenal and salivary glands and choroidal melanoma [1-3]. The ... extraocular muscles can present as isolated diplopia in the absence of a history of systemic malignancy. 4. Local ophthalmic signs may be subtle or minimal in...
Ngày tải lên: 11/08/2014, 21:22
Báo cáo y học: "Endoscopic Facet Debridement for the treatment of facet arthritic pain – a novel new technique
... 40% of patients had relief for at least 12 months, and mean duration of pain relief was 14 months. Barlocher et al. 1 treated 50 patients with cryorhizotomy of the medial branch. At 1-year ... similar ef- ficacy. In a study of 76 patients treated via CT-guided cryorhizotomy of the dorsal nerve medial branch, Staender et al. 17 reported a mean VAS pain score...
Ngày tải lên: 26/10/2012, 09:32
Báo cáo y học: "Godoy & Godoy technique in the treatment of lymphedema for under-privileged populations."
... and evaluate new therapeutic alternatives for the treatment of lymphedema. Godoy & Godoy’s novel approach to the treatment of lymphedema Over the last few years, Godoy & Godoy have ... of the limb. These exercises are specific and require knowledge of the venous and lymphatic anatomy and physiology. Continuous guidance and evaluation of patients...
Ngày tải lên: 26/10/2012, 09:39
Báo cáo y học: " Vacuum-assisted closure in the treatment of early hip joint infection"
... contamination, usually leading to prosthesis explantation [15]. Morykwas et al. have demonstrated that the ap- plication of the V .A. C. – system increased the granu- lation tissue formation and ... and lavage of the exposed prosthesis parts. Moreover, we advance the view that an adequate wound closure can only be performed after an exact anatomical preparation and mo...
Ngày tải lên: 26/10/2012, 09:53