Báo cáo y học: "linical experience in T cell deficient patients" ppsx
Báo cáo y học: "linical experience in T cell deficient patients" ppsx
... defect, their risk of particular infections and
therefore the best treatment for them.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
TSC ... X-ray will show an
absent thymus. Hematopoietic stem cell transplantation
is the definitive treatment; trials of gene therapy are
ongoing, with mixed results. Supportive treatment
should be i...
Báo cáo y học: "The role of T cell interleukin-17 in conducting destructive arthritis: lessons from animal models" pps
... in T cell immunity and/or
propagation of joint inflammation
In arthritis, IL-17 is a pro-inflammatory cytokine thought to
contribute to the joint inflammatory process [38]. Studies
in IL-17 -deficient ... anti-IL-1 therapy. Anti-
IL-17 cytokine therapy might be an interesting new anti-
rheumatic approach that could contribute to the
prevention of joint destruction as an adjunct to...
Báo cáo y học: "Thymic function and T cell parameters in a natural human experimental model of seasonal infectious diseases and nutritional burden" potx
... et al[33]. Briefly, commercially obtained telo-
mere specific primers; CGGTTTGT TTGGGTTTGG
GTTTGGGTTTGGGTTTGGGTT (forward) and GGC
TTGCCTTACCCTTACCCTTACCCTTACCCTTACC
CT (reverse), were used to ... spectra types of most of the
24 TCRVb types analyzed, it emerged from the initial
analyses that the CD4
+
T cell subset consistently exhib-
ited normal spectra type distributions consequently
fu...
Báo cáo y học: " Characteristics of CD8+ T cell subsets in Chinese patients with chronic HIV infection during initial ART" doc
... ART and provide insights for understanding of immune
status during ART.
Background
CD8+ T cells play an important role in protection against
intracellular pathogens. Eliminating CD8+ T lymphocytes
from ... subsets during early period of ART have not been fully studied.
Methods: Twenty-one asymptomatic treatment-naive HIV-infected patients with CD4 T+ cells less than 350 cells/μl
were e...
Báo cáo y học: "Special considerations in the treatment of patients with bipolar disorder and medical co-morbidities"
... known to affect the QT interval), high doses of
antipsychotics, or symptoms possibly related to arrhyth-
mias (syncope, palpitations, dizziness, etc.). The QTc
interval may not reliably predict the ... hepatic toxicity and dis-
continuing treatment are important in optimizing recov-
ery. Early symptoms of hepatic toxicity include apathy,
malaise, fever, diminished appetite, nausea, and vomi...
Báo cáo y học: "Neuropsychological patterns in systemic lupus erythematosus patients with depression" potx
... Finger Tapping Test (dominant and non-
dominant hands) [32]. Reliability and validity for this test bat-
tery have been demonstrated [28] by comparison to a larger
battery and by test-retest ... Examination-Complex Ideational Material Test; PASAT: Paced Auditory Serial Addition Test; Story learning: Learning component of Story
Memory Test; Story recall: Delayed component of Story Memory ......
Báo cáo y học: "Joining forces in the quest for orthologs" ppsx
... Centre in Hinxton, UK in July 2009, to jointly
address these issues by bringing together for the first time
key representatives of the major methods and databases in
the field of orthology ... (Smurfit Institute of
Genetics, Dublin, Ireland) gave two examples of how
augmenting current methods with additional information
(protein-protein interaction and synteny data, respectively)...
Báo cáo y học: "Host transcription in active and latent tuberculosis" ppsx
... patients
with clinically latent disease but transcriptional signa-
tures consistent with active disease have greater bacterial
burdens than other latently infected patients.
In fact, recent ... and latent infection. Between 10
and 25% of the latently infected individuals had trans-
criptional profiles that clustered with those from patients
with active disease. It is intriguing to specul...
Báo cáo y học: "Proximal myopathy in lacto-vegetarian Asian patients responding to Vitamin D and calcium supplement therapy - two case reports and review of the literature" ppt
... replacement therapy. These patients were at risk
of osteomalacia due to their dietary intak e and ethnicity. The role of dietary intake and sunlight exposure in the
development of osteomalacia in certain ... 1):192.
doi:10.1186/1752-1947-5-178
Cite this article as: Thabit et al.: Proximal myopathy in lacto-vegetarian
Asian patients responding to Vitamin D and calcium supplement
therapy...
Báo cáo y học: " Prechronous’ metastasis in clear cell renal cell carcinoma: a case report" pot
... only
subsequently following metastatectomy. This phenom-
enon has been reported once before in the setting of
lung cancer, where a 51-year-old woman presented with
symptomatic brain metastasis [2], where the ... blood or body cavity.
They deposit at nea rby or distant sites before prolifer at-
ing to colonize ectopic tissues. It is recognized that
metastases have a predilection for certain...
Từ khóa: