Báo cáo y học: "linical experience in T cell deficient patients" ppsx

Báo cáo y học: "linical experience in T cell deficient patients" ppsx

Báo cáo y học: "linical experience in T cell deficient patients" ppsx

... defect, their risk of particular infections and therefore the best treatment for them. Competing interests The authors declare that they have no competing interests. Authors' contributions TSC ... X-ray will show an absent thymus. Hematopoietic stem cell transplantation is the definitive treatment; trials of gene therapy are ongoing, with mixed results. Supportive treatment should be i...

Ngày tải lên: 08/08/2014, 21:20

10 367 0
Báo cáo y học: "The role of T cell interleukin-17 in conducting destructive arthritis: lessons from animal models" pps

Báo cáo y học: "The role of T cell interleukin-17 in conducting destructive arthritis: lessons from animal models" pps

... in T cell immunity and/or propagation of joint inflammation In arthritis, IL-17 is a pro-inflammatory cytokine thought to contribute to the joint inflammatory process [38]. Studies in IL-17 -deficient ... anti-IL-1 therapy. Anti- IL-17 cytokine therapy might be an interesting new anti- rheumatic approach that could contribute to the prevention of joint destruction as an adjunct to...

Ngày tải lên: 09/08/2014, 06:22

9 295 0
Báo cáo y học: "Thymic function and T cell parameters in a natural human experimental model of seasonal infectious diseases and nutritional burden" potx

Báo cáo y học: "Thymic function and T cell parameters in a natural human experimental model of seasonal infectious diseases and nutritional burden" potx

... et al[33]. Briefly, commercially obtained telo- mere specific primers; CGGTTTGT TTGGGTTTGG GTTTGGGTTTGGGTTTGGGTT (forward) and GGC TTGCCTTACCCTTACCCTTACCCTTACCCTTACC CT (reverse), were used to ... spectra types of most of the 24 TCRVb types analyzed, it emerged from the initial analyses that the CD4 + T cell subset consistently exhib- ited normal spectra type distributions consequently fu...

Ngày tải lên: 10/08/2014, 05:21

11 527 0
Báo cáo y học: " Characteristics of CD8+ T cell subsets in Chinese patients with chronic HIV infection during initial ART" doc

Báo cáo y học: " Characteristics of CD8+ T cell subsets in Chinese patients with chronic HIV infection during initial ART" doc

... ART and provide insights for understanding of immune status during ART. Background CD8+ T cells play an important role in protection against intracellular pathogens. Eliminating CD8+ T lymphocytes from ... subsets during early period of ART have not been fully studied. Methods: Twenty-one asymptomatic treatment-naive HIV-infected patients with CD4 T+ cells less than 350 cells/μl were e...

Ngày tải lên: 10/08/2014, 05:22

7 338 0
Báo cáo y học: "Special considerations in the treatment of patients with bipolar disorder and medical co-morbidities"

Báo cáo y học: "Special considerations in the treatment of patients with bipolar disorder and medical co-morbidities"

... known to affect the QT interval), high doses of antipsychotics, or symptoms possibly related to arrhyth- mias (syncope, palpitations, dizziness, etc.). The QTc interval may not reliably predict the ... hepatic toxicity and dis- continuing treatment are important in optimizing recov- ery. Early symptoms of hepatic toxicity include apathy, malaise, fever, diminished appetite, nausea, and vomi...

Ngày tải lên: 25/10/2012, 10:51

10 710 0
Báo cáo y học: "Neuropsychological patterns in systemic lupus erythematosus patients with depression" potx

Báo cáo y học: "Neuropsychological patterns in systemic lupus erythematosus patients with depression" potx

... Finger Tapping Test (dominant and non- dominant hands) [32]. Reliability and validity for this test bat- tery have been demonstrated [28] by comparison to a larger battery and by test-retest ... Examination-Complex Ideational Material Test; PASAT: Paced Auditory Serial Addition Test; Story learning: Learning component of Story Memory Test; Story recall: Delayed component of Story Memory ......

Ngày tải lên: 09/08/2014, 10:20

10 798 1
Báo cáo y học: "Joining forces in the quest for orthologs" ppsx

Báo cáo y học: "Joining forces in the quest for orthologs" ppsx

... Centre in Hinxton, UK in July 2009, to jointly address these issues by bringing together for the first time key representatives of the major methods and databases in the field of orthology ... (Smurfit Institute of Genetics, Dublin, Ireland) gave two examples of how augmenting current methods with additional information (protein-protein interaction and synteny data, respectively)...

Ngày tải lên: 09/08/2014, 20:20

3 294 0
Báo cáo y học: "Host transcription in active and latent tuberculosis" ppsx

Báo cáo y học: "Host transcription in active and latent tuberculosis" ppsx

... patients with clinically latent disease but transcriptional signa- tures consistent with active disease have greater bacterial burdens than other latently infected patients. In fact, recent ... and latent infection. Between 10 and 25% of the latently infected individuals had trans- criptional profiles that clustered with those from patients with active disease. It is intriguing to specul...

Ngày tải lên: 09/08/2014, 22:23

2 359 0
Báo cáo y học: "Proximal myopathy in lacto-vegetarian Asian patients responding to Vitamin D and calcium supplement therapy - two case reports and review of the literature" ppt

Báo cáo y học: "Proximal myopathy in lacto-vegetarian Asian patients responding to Vitamin D and calcium supplement therapy - two case reports and review of the literature" ppt

... replacement therapy. These patients were at risk of osteomalacia due to their dietary intak e and ethnicity. The role of dietary intake and sunlight exposure in the development of osteomalacia in certain ... 1):192. doi:10.1186/1752-1947-5-178 Cite this article as: Thabit et al.: Proximal myopathy in lacto-vegetarian Asian patients responding to Vitamin D and calcium supplement therapy...

Ngày tải lên: 11/08/2014, 00:23

3 286 0
Báo cáo y học: " Prechronous’ metastasis in clear cell renal cell carcinoma: a case report" pot

Báo cáo y học: " Prechronous’ metastasis in clear cell renal cell carcinoma: a case report" pot

... only subsequently following metastatectomy. This phenom- enon has been reported once before in the setting of lung cancer, where a 51-year-old woman presented with symptomatic brain metastasis [2], where the ... blood or body cavity. They deposit at nea rby or distant sites before prolifer at- ing to colonize ectopic tissues. It is recognized that metastases have a predilection for certain...

Ngày tải lên: 11/08/2014, 00:23

4 354 0
Từ khóa:
w