Báo cáo khoa học: " Ecophysiology and field performance of black spruce (Picea mariana): a review" ppsx

... Review article Ecophysiology and field performance of black spruce (Picea mariana): a review MS Lamhamedi PY Bernier Natural Resources Canada, Canadian Forest Service, ... seedlings in sand beds. High opti- Zine El Abidine A, Bernier PY, Plamondon AP (1994) Water relations parameters of lowland and upland black spruce: seasonal variati...

Ngày tải lên: 08/08/2014, 19:21

... anal- ysed using analysis of variance (ANOVA). Its use supposes the lay-out to be orthogonal (all treatments have living and healthy plants in all blocks) and each variable must ... above ground line. At Varanguebec, an additional final measure- ment was made on wind-stability because of wind-throw damage in January 1995 due to exceptional mont...

Ngày tải lên: 08/08/2014, 14:21

... relations between quality parameters (at plant and batch levels) or between performance parameters (at batch level). To compare quality parameters and field performance at batch ... quality and field performance Regarding rank correlations (table V), REL was sys- tematically independent of performance parameters, whereas RMC was significantly...

Ngày tải lên: 08/08/2014, 14:21

... Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target Louise Egeblad-Welin 1 , Martin Welin 2, *, Liya Wang 1 and Staffan Eriksson 1 1 Department ... Essential genes of a minimal bacte- rium. Proc Natl Acad Sci USA 103, 425–430. 12 Yamanaka K, Ogura T, Niki H & Hiraga S (1992) Identification and characterization of...

Ngày tải lên: 18/02/2014, 16:20

... total RNA was treated with DNaseI (SIGMA) before use. RNA quality and quantity was assessed with an RNA Nano assay on a Bioanalyzer 2100 (Agilent). Poly (A) +RNA was extracted from the samples ... 1.5 mL of RNAlater (Ambion) for subsequent transcriptome profiling and the other half was placed in a vial containing 1 mL of hexane with 57 ngµL -1 pentadecane as internal standa...

Ngày tải lên: 11/08/2014, 11:21

... Soumita Basu, Gitanjali Priti Bhatia, Samita Bhattarai, Erin Court, Abhijit Das, Stefan Ecks, Patricia Jeffery, Rachel Manners, Allyson Pollock, and Liz Richardson. Martin Chautari (Kathmandu) and ... Drug Administration (DDA) ’To regulate all functions relating drug like misuse and abuse of drugs and its raw materials, to stop false and misleading advertisement and make availab...

Ngày tải lên: 11/08/2014, 14:21

... inhibitors of RNase A Nethaji Thiyagarajan 1 , Bryan D. Smith 2, *, Ronald T. Raines 2,3 and K. Ravi Acharya 1 1 Department of Biology and Biochemistry, University of Bath, UK 2 Department of Biochemistry, ... nucleic acid-binding proteins. Database Structural data for the two RNase A complexes are available in the Protein Data Bank under accession numbers 2xog and 2xoi Abbr...

Ngày tải lên: 14/02/2014, 22:20

... GCATCAACTTTCAAAAGAT F127E CGAGATAAGGGGACCAG TTAAATCCATGTGCACAG R144E AGAAGATGACACTGAAAG TGAATAAATTTATTTGGATAC I152D CGATCTGAACACACTATTC TAAAATCTTTCAGTGTCAT N154D GGACACACTATTCAACCT AGAATGTAAAATCTTTCAGT K31 1A ... AAGAAAGTAACTGACGACATGGACATGTG CACATGTCCATGTCGTCAGTTACTTTCTT Y55G AGTGTTTTGGGTTTGACATGGATGGCACACTTGCTG CAGCAAGTGTGCCATCCATGTCAAACCCAAAACACT T56V AGTGTTTTGGGTTTGACATGGATTATGTGCTTGCTG...

Ngày tải lên: 15/02/2014, 01:20

... methylation of GPR150, ITGA8 and HOXD11 in ovarian cancers. Life Sci 80, 1458–1465. 9 Suzuki E, Imoto I, Pimkhaokham A, Nakagawa T, Kamata N, Kozaki KI, Amagasa T & Inazawa J (2007) PRTFDC1, a ... filter paper assay and tritium-labeled substrates. Experiments have been repeated three to four times and the data are given as the mean ± SD. k cat was calculated using M w (HPRT) = 2...

Ngày tải lên: 15/02/2014, 01:20

... molecular basis of enzyme thermosta- bility. J Bacteriol 185, 4038–4049. 20 Nanba H, Yajima K, Takano M, Yamada Y, Ikenaka Y & Takahashi S (1997) Process for producing d-N-car- bamoyl -a- amino acid. ... molecular mass was also estimated by SDS–PAGE. Characterization and comparative analyses of HYD Js and HYD Bp The optimal temperature for activity of HYD Js with d-p- HPH as sub...

Ngày tải lên: 18/02/2014, 08:20