Báo cáo khoa học: "Micropropagation and restricted-growth storage of adult oak" ppsx

Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt

Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt

... dinucleoside inhibitors of RNase A Nethaji Thiyagarajan 1 , Bryan D. Smith 2, *, Ronald T. Raines 2,3 and K. Ravi Acharya 1 1 Department of Biology and Biochemistry, University of Bath, UK 2 Department of ... nucleic acid-binding proteins. Database Structural data for the two RNase A complexes are available in the Protein Data Bank under accession numbers 2xog and...

Ngày tải lên: 14/02/2014, 22:20

9 627 0
Tài liệu Báo cáo khoa học: Active and regulatory sites of cytosolic 5¢-nucleotidase doc

Tài liệu Báo cáo khoa học: Active and regulatory sites of cytosolic 5¢-nucleotidase doc

... structure of cN-II showing interfaces A and B and the Mg 2+ site. The inset shows the tertiary structure of each subunit. Effector sites 1 and 2 and the active site are shown. Table 2. Effect of point ... Active and regulatory sites of cytosolic 5Â-nucleotidase Rossana Pesi 1 , Simone Allegrini 2 , Maria Giovanna Careddu 1,2 , Daniela Nicole Filoni 1 , Marcella C...

Ngày tải lên: 15/02/2014, 01:20

10 563 0
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... 10 6 (10 0%) Guanine PRTFDC1 36 .1 ± 14 .3 2.9 ± 0.7 1. 36 ± 0.34 3.9 · 10 4 ± 9.3 · 10 3 (0.09%) HPRT 9.9 ± 0.2 899 ± 11 7 406 ± 53 4.5 · 10 7 ± 1. 0 · 10 7 (10 0%) M. Welin et al. Studies of the human ... Gene duplication and inactivation in the HPRT gene family. Genomics 89 , 13 4 14 2. 11 Nicklas JA (2006) Pseudogenes of the human HPRT1 gene. Environ M...

Ngày tải lên: 15/02/2014, 01:20

11 770 0
Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx

Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx

... Y. Cai et al. 3584 FEBS Journal 276 (2009) 35753588 ê 2009 The Authors Journal compilation ê 2009 FEBS Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 Yuanheng ... subunit molecular mass was also estimated by SDS–PAGE. Characterization and comparative analyses of HYD Js and HYD Bp The optimal temperature for activi...

Ngày tải lên: 18/02/2014, 08:20

14 621 0
Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: electron transfer through the nitric oxide synthase flavoprotein domain pdf

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: electron transfer through the nitric oxide synthase flavoprotein domain pdf

... inducible nitric oxide synthase; nNOS, neuronal nitric oxide synthase; nNOSr, reductase domain of neuronal NOS; NO, nitric oxide; NOS, nitric oxide synthase; NOSoxy, oxygenase domain of NOS. FEBS ... further test the validity, kinetics and thermodynam- ics of the through- heme pathway in NOS enzymes. Conclusions Although the NOS flavoprotein domain ha...

Ngày tải lên: 18/02/2014, 11:20

16 640 0
Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: probes of hydrogen tunnelling pptx

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: probes of hydrogen tunnelling pptx

... et al. Hydrogen tunnelling in biological systems FEBS Journal 276 (2009) 39303941 ê 2009 The Authors Journal compilation ê 2009 FEBS 3933 MINIREVIEW Structural and mechanistic aspects of flavoproteins: probes ... flavoproteins: probes of hydrogen tunnelling Sam Hay, Christopher R. Pudney and Nigel S. Scrutton Manchester Interdisciplinary Biocentre and Facult...

Ngày tải lên: 18/02/2014, 11:20

12 596 0
Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: photosynthetic electron transfer from photosystem I to NADP+ doc

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: photosynthetic electron transfer from photosystem I to NADP+ doc

... of the 50’s loop in the Clostridium beijerinckii flavodoxin: evaluation of additivity and the importance of interac- tions provided by the main chain in the modulation of the oxidation-reduction ... activity of Fld derives from its FMN cofac- tor. The Fld semiquinone is exceptionally stable and its midpoint potentials are quite negative. This is a direct consequence of the di...

Ngày tải lên: 18/02/2014, 11:20

17 635 0
Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

... Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target Louise Egeblad-Welin 1 , Martin Welin 2, *, Liya Wang 1 and Staffan Eriksson 1 1 ... in GTP activation. F133 was mutated to Asn in an attempt to create a GTP-activated enzyme, and F13 3A was prepared and tested as a control. Neither of t...

Ngày tải lên: 18/02/2014, 16:20

12 657 0
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

... 5Â-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3Â and a reverse oligomer 5Â-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3Â. For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the C-terminus ... addition to an N-terminal Nco1 cloning site. The forward o ligomer 5 Â-TCCGAAACCAGCG GCCGCTT TATCGCGTTA AAAC CGGT GATCAA ACCCC -3Â and the reverse oligomer 5Â-GTAGGCCTT...

Ngày tải lên: 19/02/2014, 06:20

10 648 0
Tài liệu Báo cáo khoa học: Purification and sequence identification of anserinase ppt

Tài liệu Báo cáo khoa học: Purification and sequence identification of anserinase ppt

... expected sizes of the amplified bands of anserinase, CNDP-like protein and GAPDH were 530, 395 and 517 bp, respectively. S. Yamada et al. Purification and sequence identication of anserinase FEBS ... 56 bp of 5Â UTR, 1482 bp of ORF, and 299 bp of 3Â UTR. The coding region of the sequence was translated into 494 amino acids, which included a typical signal peptide o...

Ngày tải lên: 19/02/2014, 07:20

13 672 0
Tài liệu Báo cáo khoa học: Structure and membrane interaction of the internal fusion peptide of avian sarcoma leukosis virus pdf

Tài liệu Báo cáo khoa học: Structure and membrane interaction of the internal fusion peptide of avian sarcoma leukosis virus pdf

... Structural study of internal fusion peptide of ASLV (Eur. J. Biochem. 271) 4729 Structure and membrane interaction of the internal fusion peptide of avian sarcoma leukosis virus Shu-Fang Cheng, ... Kantchev and Ding-Kwo Chang Institute of Chemistry, Academia Sinica, Taipei, Taiwan, Republic of China The structure and membrane interaction...

Ngày tải lên: 19/02/2014, 16:20

12 590 0
Báo cáo khoa học: "Micropropagation and ex vitro rooting of several clones of late-flushing Quercus robur " ppsx

Báo cáo khoa học: "Micropropagation and ex vitro rooting of several clones of late-flushing Quercus robur " ppsx

... we re- port the micropropagation of late-flushing Q robur from acorns of selected trees. To our knowledge, results of ex vitro rooting of micropropagated oak are presented here ... to 0.2 mg/l. Ex vitro rooting experiments were carried out in April and May 1991 after the 4th and the 5th subcultures. In April, 925 microcuttings of...

Ngày tải lên: 08/08/2014, 19:21

4 182 0
Báo cáo khoa học: "Micropropagation and restricted-growth storage of adult oak" ppsx

Báo cáo khoa học: "Micropropagation and restricted-growth storage of adult oak" ppsx

... labor and expense of repeated subculture, we lowered the growth temperature of shoot-tip cultures from the normal of 26 °C to 15, 10 and 4 °C. The subculture period of 5 ... article Micropropagation and restricted-growth storage of adult oak genotypes K Gebhardt, U Frühwacht-Wilms H Weisgerber Forschungsinstitut für Schnell Wachsende Baumarti...

Ngày tải lên: 08/08/2014, 19:21

7 232 0
Báo cáo khoa học: "Physiological and pathological aspects of long-term storage of acorns" potx

Báo cáo khoa học: "Physiological and pathological aspects of long-term storage of acorns" potx

... Original article Physiological and pathological aspects of long-term storage of acorns J Guthke W Spethmann Universität Hannover, Institut für ... development of a seedlot of oak has been followed over a period of 32 months. During the observation period, the absolute starch content of acorns and the exploitation of starch reserves ... t...

Ngày tải lên: 08/08/2014, 19:21

4 166 0
Báo cáo khoa học: "Micropropagation and rejuvenation Sequoia sempervirens (Lamb) Endl: a review" pdf

Báo cáo khoa học: "Micropropagation and rejuvenation Sequoia sempervirens (Lamb) Endl: a review" pdf

... identification and characteristics. Am For 22, 270, 323-328 Review article Micropropagation and rejuvenation of Sequoia sempervirens (Lamb) Endl: a review Y Arnaud A Franclet H Tranvan M ... explants (growth regulators were 2.4.5-T and SD 8339). After elongation on a medium lacking cytokinin and containing activated charcoal and auxin, t...

Ngày tải lên: 08/08/2014, 23:22

23 215 0
w