Báo cáo sinh học: "The molecular epidemiology of Stenotrophomonas maltophilia bacteraemia in a tertiary referral hospital in the United Arab Emirates 2000–2004" pot
Báo cáo sinh học: "The molecular epidemiology of Stenotrophomonas maltophilia bacteraemia in a tertiary referral hospital in the United Arab Emirates 2000–2004" pot
... on S. mal- tophilia from the UAE. However, S. maltophilia is an estab- lished pathogen in Tawam Hospital, which is a major tertiary referral hospital in the UAE. In a recent study of paediatric ... data included: age; clinical department; underlying disease; whether the infection was hospital- acquired; origin of bacteraemia; presence of a central venous ca...
Ngày tải lên: 08/08/2014, 19:20
báo cáo sinh học:" Sustainable scaling up of good quality health worker education for tuberculosis control in Indonesia: a case study" doc
... facilitate the plan- ning and preparation of provincial and district training activities, and guidance for quality assurance of training courses. The training methodology included an ongoing assessment ... the training program. 6. Inclusion of TB case management in pre-service training curricula The plan included activities to initiate the process to update curricula in na...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" Training health care workers to promote HIV services for patients with tuberculosis in the Democratic Republic of Congo" pptx
... developing the training. AVR conceived of the study, participated in developing the training, coordinated the study with FB and helped to draft the manuscript. All authors read and approved the final ... consisting of a partici- pant's manual, a trainer's manual, Power Point ® slides, a training evaluation questionnaire and the revised treat- ment card can...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" "I won''''t be staying here for long": a qualitative study on the retention of migrant nurses in Ireland" ppt
... an understanding of meaning in complex data through the development of summary themes or categories from the raw data" [26]. Data management was facilitated by the use of the MaxQDA qualitative data analysis ... to ensure that the quantity of data remained at manageable levels. A point of data saturation was quickly reached – the point at which the researcher...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo sinh học: " Attenuation and efficacy of human parainfluenza virus type 1 (HPIV1) vaccine candidates containing stabilized mutations in the P/C and L genes" potx
... formal demonstration in a clinical trial using clinical grade virus preparations. Evaluation of the two vaccine candidates revealed that they are reasonable candidates for further study in clinical trials. ... performing the HAI assays and Emerito Amaro-Carambot for assistance with sequencing. We are grateful to Pamela Shaw and Dean Follman for assistance with statistical analy...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: " Open Access Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" docx
... +10 GCGGGTTCAAAAACTACTATAGGTAGGCAG Drosophila TGCCTTATATGTTCGTCTGTAGGAGCGAGT Chicken GCATGTGCGGGCAGGAAGGTAGGGGAAGAC Xenopus TATTGTACCTGGAGATATATGCTGACACGC Rat TATTGGACCTGGAGATAGGTACTGACACGC Mouse TTTGGGCCGCCGGGTTATATGCTGACACGC ... 1960 (1851) TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG canus fam EcoRI BamHI (...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: "Bisphosphonate-associated osteonecrosis of the jaw is linked to suppressed TGFb1-signaling and increased Galectin-3 expression: A histological study on biopsies" pot
... inhi- bition of intraoral inflammation [1,16]. Galectin-3 was shown to specifically inhibit LPS-associated cytokine activation, a characteristic of intraoral gram negative bacteria [16]. The potential ... dewaxed in grade d alcohol in preparation for immunohistochemical stain- ing. Immunohistochemical staining was performed with the alkaline phosphatase-anti-alkaline phosphatase...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo sinh học: " Possible active origin of replication in the double stranded extended form of the left terminus of LuIII and its implication on the replication model of the parvovirus" pptx
... provided in trans. This extended hairpin, capable of acting as an origin of replication, lacks the arrangement of the specific domains present in the dimer duplex intermediate of MVM, the only active ... Lt-Lt/pGlu∆Xba and, LuIII Lt-Lt/pCMVNS1, contrib- uted in the analysis and interpretation of the data, partic- ipated in the design of the models proposed...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo sinh học: " Research Article Solutions of Linear Impulsive Differential Systems Bounded on the Entire Real Axis" ppt
... Entire Real Axis Alexandr Boichuk, Martina Langerov ´ a, and Jaroslava ˇ Skor ´ ıkov ´ a Department of Mathematics, Faculty of Science, University of ˇ Zilina, 010 26 ˇ Zilina, Slovakia Correspondence ... Russia, 1971. 4 ˇ S. Schwabik, M. Tvrdy, and O. Vejvoda, Differential and Integral Equations, Boundary Value Problems and Adjoints, Academia, Prague, 1979. 5 A. A. Boichuk and...
Ngày tải lên: 21/06/2014, 16:20
Báo cáo sinh học: " Research Article Development of the Database for Environmental Sound Research and Application " pot
... “N /A . Rhythmically and Temporally Related Variables (1) Amplitude slope (reflects the initial attack and decay of a sound). (2) Autocorrelation peaks (indicating the degree and period of the ... originator will have the option to remove one of their sounds from the database. 8.4. Database. Participants can add or edit audio data on sounds they originate and can make ratings...
Ngày tải lên: 21/06/2014, 16:20