Báo cáo khoa học: "Aboveground biomass in a beech forest and a Scots pine plantation in the Sierra de la Demanda area of northern Spain" pdf

Báo cáo khoa học: "Aboveground biomass in a beech forest and a Scots pine plantation in the Sierra de la Demanda area of northern Spain" pdf

Báo cáo khoa học: "Aboveground biomass in a beech forest and a Scots pine plantation in the Sierra de la Demanda area of northern Spain" pdf

... article Aboveground biomass in a beech forest and a Scots pine plantation in the Sierra de la Demanda area of northern Spain I Santa Regina 1 T Tarazona R Calvo 3 1 IRNA-CSIC; 2 JCL; 3 INIA, ... in beech and pine forests indicates a larger biomass and litterfall in the latter. Although the produc- tivity according to dia...

Ngày tải lên: 08/08/2014, 18:21

9 261 0
Báo cáo khoa học: "Combining POMDPs trained with User Simulations and Rule-based Dialogue Management in a Spoken Dialogue System" docx

Báo cáo khoa học: "Combining POMDPs trained with User Simulations and Rule-based Dialogue Management in a Spoken Dialogue System" docx

... (section 4). The appli- cation domain is a tourist information system for accommodation and events in the local area. The domain of the trained DMs is identical to that of a rule-based DM that was used ... Italy {varges|silviaq|riccardi|ivanov|roberti}@disi.unitn.it Abstract Over several years, we have developed an approach to spoken dialogue systems that includes rule-ba...

Ngày tải lên: 23/03/2014, 17:20

4 269 0
Tài liệu Báo cáo khoa học: "An Alignment Algorithm using Belief Propagation and a Structure-Based Distortion Model" pdf

Tài liệu Báo cáo khoa học: "An Alignment Algorithm using Belief Propagation and a Structure-Based Distortion Model" pdf

... that arise often (and are often intractable) in the use of a proba- bilistic model: “what are the marginal probabili- ties of each individual variable?” and “what is the set of values with the ... concepts as a pair of sentence (e, f), plus an alignment a. a is a set of links, a link being represented as a pair of positions in each side of the sent...

Ngày tải lên: 22/02/2014, 02:20

9 456 0
báo cáo khoa học: " Cross-species EST alignments reveal novel and conserved alternative splicing events in legumes" ppsx

báo cáo khoa học: " Cross-species EST alignments reveal novel and conserved alternative splicing events in legumes" ppsx

... GAATGGATATTAAAGGAGTTGTTGCAGAGATCCTAATGGACAAAAATACGTCTCTTGTGCAAAAG At2E3 GGATGGATATTAAAGGAGTTGCTGCAGAAATCCAAAAGGACAAAAACACACCTCTTGTGCAAAAG OsE3 GGATGGATATTAAGGGTGTTGCAGCAGAAATTCAAAAGGACAAGAGCACACCACTTGTGCAAAAG ... V A E I Q K D K S T P L V Q K MtE3 GTATGGATATTAAAGGGGTTGTTGCTGAAATACAGAAGGACAAAAGCACACCTTTAGTGCAAAAG LjE3 GTATGGATATTAAAGGGGTTGTTGCTGAAATACAAAAGGACAAAAGCACACCTTTAGTGCAGAAG AtE3 GA...

Ngày tải lên: 12/08/2014, 05:20

13 310 0
Báo cáo khoa học: " Systemic hypothermia increases PAI-1 expression and accelerates microvascular thrombus formation in endotoxemic mice" ppsx

Báo cáo khoa học: " Systemic hypothermia increases PAI-1 expression and accelerates microvascular thrombus formation in endotoxemic mice" ppsx

... with the German legislation on pro- tection of animals and the National Institutes of Health 'Guide for the Care and Use of Laboratory Animals' (Institute of Lab- oratory Animal Resources, ... to faint staining; 2 to moderate staining; and 3 to intense staining. As there were no notable differences in arteriolar and venular endothelial staining, ves- sels wer...

Ngày tải lên: 13/08/2014, 03:20

9 222 0
Báo cáo khoa học: "Root biomass and biomass increment in a beech (Fagus sylvatica L.) stand in North-East France." doc

Báo cáo khoa học: "Root biomass and biomass increment in a beech (Fagus sylvatica L.) stand in North-East France." doc

... R., Aboveground biomass in a beech forest and a Scots pine plantation in the Sierra de la Demanda area of northern Spain, Ann. Sci. For. 54 (1997) 261–269. [33] Stober C., Eckart G .A. , Persson H., ... means that root system biomass continues to increase at a steady rate with age, but also that the rate of increase of root system biomass decr...

Ngày tải lên: 08/08/2014, 14:21

13 375 0
Báo cáo khoa học: "Belowground biomass and nutrient content in a 47-year-old Douglas-fir plantation" pptx

Báo cáo khoa học: "Belowground biomass and nutrient content in a 47-year-old Douglas-fir plantation" pptx

... root biomass was 58 t of dry matter, which was 18% of the total stand biomass. A linear model characterized the relationships bet- ween aerial and belowground biomass of 38 Douglas-fir stands ... 0.9. A rather low coeffi- 426 J. Ranger and D. Gelhaye Table II. Main stand characteristics. Number of trees per ha Mean tree circumference Mean tree basal area Basal area...

Ngày tải lên: 08/08/2014, 14:21

8 229 0
Tài liệu Báo cáo khoa học: "Discriminative Lexicon Adaptation for Improved Character Accuracy – A New Direction in Chinese Language Modeling" pptx

Tài liệu Báo cáo khoa học: "Discriminative Lexicon Adaptation for Improved Character Accuracy – A New Direction in Chinese Language Modeling" pptx

... with the least modification of the original model. Of course the modification of language models led by the addi- tion and deletion of words is hard to quantify and we choose to add and delete as ... si- multaneously add and delete words. + and - means the number of words added and deleted, respec- tively. For the proposed LAICA approach, we show the results...

Ngày tải lên: 20/02/2014, 07:20

9 466 0
Tài liệu Báo cáo khoa học: Trophoblast-like human choriocarcinoma cells serve as a suitable in vitro model for selective cholesteryl ester uptake from high density lipoproteins pdf

Tài liệu Báo cáo khoa học: Trophoblast-like human choriocarcinoma cells serve as a suitable in vitro model for selective cholesteryl ester uptake from high density lipoproteins pdf

... which maintains the ability of proliferation and invasion. Choriocarcinoma is a malignant neoplasm that represents the early trophoblast of the attachment phase or as later invasive stage [46–48]. ... reported that HDL 3 was taken up and degraded by BeWo cells in a time- and concentration-dependent fashion, but the rate of degradation was considerably less than was...

Ngày tải lên: 20/02/2014, 23:20

12 470 0
Báo cáo khoa học: Organizational constraints on Ste12 cis-elements for a pheromone response in Saccharomyces cerevisiae docx

Báo cáo khoa học: Organizational constraints on Ste12 cis-elements for a pheromone response in Saccharomyces cerevisiae docx

... 0.81 ATcAAACA 0.03 c ATtAAACA 0.01 c ATGcAACA 0.69 ATGgAACA 0.20 c I ATGAgACA 0.02 c ATGAAgCA 0.05 c ATGAAAgA 0.30 III ATGAAACg 0.26 a PREs represented in the FUS1 promoter (Fig. 4B). b RCS for each oligo ... significant Table 1. RCS of mutant PREs for binding of wild-type Ste12 to a PRE consensus (ATGAAACA) in vitro. FUS1 PRE a Sequence RCS b II ATGAAACA 1.00 IV tTGAAACA 0.27...

Ngày tải lên: 06/03/2014, 22:21

14 428 0
w