Báo cáo khoa học: "Endurcissement à la sécheresse et accumulation de glucides solubles et d’acides aminés libres dans les phyllodes d’Acacia cyanophylla Lindl" doc

... transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro -hepatocyte growth factor Tomio Hashimoto 1 , Minoru Kato 2 , Takeshi Shimomura 2 and Naomi ... factor activator inhibitor type 1; HAI-2, hepatocyte growth factor activator inhibitor type 2; HGF, hepatocyte growth...

Ngày tải lên: 15/02/2014, 01:20

... nonribosomal peptide synthetases: the emerging view from bacterial genomics. Nat Prod Rep 24, 107 3–1 109. 32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H, Naganawa H, Hamada M & Takeuchi T (1985) ... on an analytical scale. The sensitivity of radioactivity detection and sophisti- cated analytical separation proved to be advantageous in this approach. The iron-chelating pro...

Ngày tải lên: 16/02/2014, 09:20

... compilation ê 2009 FEBS TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses Kristiina A. Vuori 1 , Johanna K. Ahlskog 2 , Lea Sistonen 2 and Mikko ... antisense AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC Scrambled oligonucleotide Bi...

Ngày tải lên: 18/02/2014, 14:20

... Journal compilation ª 2006 FEBS Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand Ian W. Jeffrey, Androulla ... sensitivity of cells to inhibition of protein synthesis by TRAIL We have previously shown that protein synthesis is rapidly downregulated fol...

Ngày tải lên: 19/02/2014, 06:20

... new family within this class. The amino acid sequence of its catalytic domain is approximately equidis- tant from those of all mammalian class I PDEs, the class I PDEs dunce of D. melanogaster,regAofD. ... TbPDE2 family. Outside of the catalytic domain, sequence similarity decrea- ses, within 10–40 amino acids at the N-terminal side of the domain, and within 15 amino acids...

Ngày tải lên: 19/02/2014, 12:20

... TSA administration has on chromatin structure and on gene expression. Materials and methods DNA and plasmids Construction of the MMTV reporter and the plasmid for in vitro transcription of rat GR mRNA has ... 2004 Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromati...

Ngày tải lên: 19/02/2014, 12:20

... Computational Linguistics Creating a manually error-tagged and shallow-parsed learner corpus Ryo Nagata Konan University 8-9-1 Okamoto, Kobe 658-0072 Japan rnagata @ konan-u.ac.jp. Edward Whittaker ... such as for gram- matical error detection. Given this back- ground, we created a novel learner corpus that was manually error-tagged and shallow- parsed. This corpus is av...

Ngày tải lên: 20/02/2014, 04:20

... 2011. c 2011 Association for Computational Linguistics MemeTube: A Sentiment-based Audiovisual System for Analyzing and Displaying Microblog Messages Cheng-Te Li 1 Chien-Yuan Wang 2 Chien-Lin ... We also integrate the sentiment-detection system with a real-time rule-based harmonic music and animation generator to display streams of messages in an audiovisual...

Ngày tải lên: 20/02/2014, 05:20

... problem of several possible answers and, in consequence, automatic evaluation has been tackled for years within another field of study: automatic summarisation (Hori et al., 2003; Lin and Hovy, 2003). ... definition of what is a correct answer, and a way to com- pare the correct answers to automatic answers produced by a system. For this purpose we present a Wikip...

Ngày tải lên: 20/02/2014, 09:20

... and Linda C. Bauman Peto. 1995. A hierarchical Dirichlet language model. Natural Lan- guage Engineering, 1(3):1–19. Y.W. Teh. 2006. A hierarchical Bayesian language model based on Pitman-Yor processes. ... n-grams: C(ab) − C(ab∗). A( ab) = max(1, K(C(ab) − C(ab∗))) A different K constant is chosen for each n-gram order. Using this formulation as an interpolated 5- gram language m...

Ngày tải lên: 20/02/2014, 09:20

... Ng and Cardie, 2003; Mota and Grishman, 2008). In particular, we showed that the perfor- mance of a name tagger based on co-training de- cays as the time gap between training data (seeds and unlabeled ... AFNLP Updating a Name Tagger Using Contemporary Unlabeled Data Cristina Mota L2F (INESC-ID) & IST & NYU Rua Alves Redol 9 1000-029 Lisboa Portugal cmota@ist.utl.p...

Ngày tải lên: 20/02/2014, 09:20

... for Computational Linguistics Archivus: A multimodal system for multimedia meeting browsing and retrieval Marita Ailomaa, Miroslav Melichar, Martin Rajman Artificial Intelligence Laboratory ´ Ecole ... afterwards used to help automate the correct behavior of the system and to increase the overall performance. 3 Collecting natural language data In order to obtain a suffic...

Ngày tải lên: 20/02/2014, 12:20

... naturelles), page to appear, Leu- ven. ATALA. Eric Brill. 1995. Transformation-based error-driven learning and natural language processing: A case study in part-of-speech tagging. Computational Lin- guistics, ... the form of recursive automata (automata that call other automata). The termi- nal symbols are lexical masks (Blanc and Dister, 2004), which are underspecified word tags i.e. that r...

Ngày tải lên: 20/02/2014, 12:20

... Article original Endurcissement à la sécheresse et accumulation de glucides solubles et d’acides aminés libres dans les phyllodes d’Acacia cyanophylla Lindl A Albouchi R Ghrir 2 MH ... des plants D : les rapports des concentrations des plants D/6 à celles des plants D sont passés de 1,60 à 5,73 pour les acides aminés libres,...

Ngày tải lên: 08/08/2014, 18:21

... Evolution au cours du repos hivernal de l’aptitude au débourrement, à l’allongement et à la ramification de bourgeons isolés de Douglas M. Jacques 1 M. Bonnet-Masimbert 3 D. ... d’étudier l’influence de l’éclairement sur les capaci- tés de développement de bourgeons de Douglas au cours de leur phase de dor- mance en conditi...

Ngày tải lên: 09/08/2014, 02:21