Báo cáo y học: "Advances in Hepatitis B Research: From Virology to Clinical Management (A Special Issue)" pot

... elimination of the virus but is also responsible for liver damage caused by the lytic activity of HBV- specific cytotoxic T lymphocytes (CTL) on HBV- infected hepatocytes and by production of inflammatory ... respectively. Interestingly, an increase in virological response over time after the discontinuation of thymosin could be observed (p=0.02) [40]. The doses of thymosin α...

Ngày tải lên: 02/11/2012, 11:17

... discovered in Central America [51]. The study of possible clinical ramifications of HBV genotypes is the subject of intense clinical research, with evidence accumulating that HBV genotyping influences ... generally defined clinically by a rise in serum HBV DNA levels during antiviral therapy. Although HBV DNA assays will eventually detect changes in viral load as a con...

Ngày tải lên: 03/11/2012, 09:41

Ngày tải lên: 08/08/2014, 18:20

... technology has been, theoretically, to increase the safety and com- pleteness of surgery in addition to increasing the confidence of the surgeon. This accounts for the increasing numbers of health ... state of the art in endoscopic sinus surgery includes many recent innovations. Prob- ably the most fundamental change in sinus surgery has been the adaptation of ri...

Ngày tải lên: 08/08/2014, 20:23

... scoring 1 to 3 in each paw (maximum of 12 points per mouse) as follows: 1, swelling or erythema in one joint; 2, swelling or erythema in two joints; 3, severe swelling of the entire paw or ankylosis. Tissue ... demonstrated. Phenotypes of bone marrow lymphocytes are influenced both by OVX and by arthritis Flow cytometry analysis was performed to evaluate the effects of OV...

Ngày tải lên: 09/08/2014, 06:23

... initially present in the small joints of the feet, and appear in the small joints of the hands at a later point in the disease course [6]. Also, rheumatoid nodules are very rare in the early phases of RA, ... evaluated. Review Advances in the genetics of rheumatoid arthritis point to subclassification into distinct disease subsets Anne...

Ngày tải lên: 09/08/2014, 10:23

... ‘Maintenance of Genome Stability’ is a biennial meeting that brings together, in a fantastic venue, diverse researchers working on how the integrity of genomes is maintained. Topics included ... extremely complex, answers to these questions will undoubtedly uncover many surprises and interesting biology that will be important in advancing our understanding of the role of ubiquit...

Ngày tải lên: 09/08/2014, 20:21

... provided the original work is properly cited. Case report Infection < /b> with < /b> hepatitis < /b> B virus carrying novel pre-S/S gene mutations in female siblings vaccinated at birth: two case reports Ming-Wei Lai 1,2 , ... progressively. However, about 1 percent of the young generation, who received hepatitis < /b> B vaccination at birth, remain c...

Ngày tải lên: 11/08/2014, 12:20

... reduc- tion. Topiramate is an anticonvulsant and its action mecha- nisms include inhibition of voltage-gated Na+ and Ca+ channels and activation of gamma-aminobutyric acid (GABA) receptors, and particularly alpha-amino-3- hydroxy-5-methyl-4-isoxazolepropionic ... suggest that aripiprazole may play a role in tobacco control. Aripiprazole has been investigated recently as a t...

Ngày tải lên: 11/08/2014, 21:22

... S5F2-TATGA TACC CGCTGCTTTGACTCG; HCVNS 5R 2c- CTGG TCA- TAGCCTCCGTGAAGGCTCTCAGG and HCVN S5 R2d-CTGGTCATAGCCTCCGTGAAGGCTCGTA GG . Statistical Analysis HBV seroprevalence was determined in the two ... NS5RnB-TACCT GGTCATAGCCTC CGTGAAG GCTC [41]. G el p uri- fied PCR products were sequenced using primers spe- cific for the 5′ UTR (KF2 - TTCACGCAGAA AGC GTCTAG and 211-CACTCTCGAGCAC CCTAT-...

Ngày tải lên: 12/08/2014, 01:21

... subgenotype of < /b> hepatitis < /b> B virus genotype A in Cameroon but not in neighbouring Nigeria. Clin Microbiol Infect 2010. 20. Bowyer SM, van Staden L, Kew MC, Sim JG: A unique segment of < /b> the hepatitis < /b> B virus ... Railway, a hallmark in Rondônia state history, that was built by many African-descendants workers in the beginning of < /b> twentieth century...

Ngày tải lên: 12/08/2014, 02:20

... al., Concerns < /b> regarding < /b> hepatitis < /b> B vaccina- tion and post -vaccination test among Brazilian dentists Virology Journal 2010, 7:154 Resende et al. Virology Journal 2010, 7:154 http://www.virologyj.com/content/7/1/154 Page ... is properly cited. Research Concerns < /b> regarding < /b> hepatitis < /b> B vaccination and post -vaccination test among...

Ngày tải lên: 12/08/2014, 04:20

... serop- ositivity of < /b> dual infection of < /b> HBV and HCV among blood donors in Nyala Teaching Hospital was (0.25%), this per- cent is in accordance with the endemic level of < /b> both viruses in South Dar ... on the combined effect of < /b> hepatitis < /b> B and C virus infec- tions in causing hepatocellular carcinoma in China. British Journal of...

Ngày tải lên: 12/08/2014, 04:21

... by macrophages and other cell types [99,100]. Therefore, one of the functions of MAP kinase signaling pathway may be to regulate the levels of cytokines or interleukines, thereby controlling cell mitosis in ... Access Review Advances in understanding the regulation of apoptosis and mitosis by peroxisome-proliferator activated receptors in pre-clini...

Ngày tải lên: 13/08/2014, 13:20

... asso- ciated with the cyclin/cyclin-dependent kinase pathway was identified. The combination of RNAi and gene- expression profiling pro- vides further insight into gene function and the regulatory networks ... Using flow cytometry, Björklund and col- leagues analyzed the RNAi-induced loss -of- function of 70% of the genes in Drosophila, including those conserved in...

Ngày tải lên: 14/08/2014, 17:22