Báo cáo y học: "Advances in Hepatitis B Research: From Virology to Clinical Management (A Special Issue)" pot
Báo cáo y học: "Advances in immunomodulating therapy of HBV infection"
... elimination of the virus but is also responsible for liver damage caused by the lytic activity of HBV- specific cytotoxic T lymphocytes (CTL) on HBV- infected hepatocytes and by production of inflammatory ... respectively. Interestingly, an increase in virological response over time after the discontinuation of thymosin could be observed (p=0.02) [40]. The doses of thymosin α-1 in this meta-analysis are ... Efficacy and limitations of a specific immunotherapy in chronic hepatitis B. J Hepatology 2001; 34: 917-921. 52. Yalcin K, Acar M, Degertekin H. Specific hepatitis B vaccine therapy in inactive...
- 6
- 406
- 0
Báo cáo y học: "Advances in Molecular Diagnosis of HBV Infection and Drug Resistance"
... discovered in Central America [51]. The study of possible clinical ramifications of HBV genotypes is the subject of intense clinical research, with evidence accumulating that HBV genotyping influences ... generally defined clinically by a rise in serum HBV DNA levels during antiviral therapy. Although HBV DNA assays will eventually detect changes in viral load as a consequence of emerging resistance ... Advances in the molecular diagnosis of drug resistance using highly sensitive methodologies such as DNA hybridization assays can further pinpoint the type of mutation responsible and, more...
- 9
- 590
- 0
Báo cáo y học: Advances in the Surgical Management of Chronic Rhinosinusitis" pot
... technology has been,theoretically, to increase the safety and com-pleteness of surgery in addition to increasing the confidence of the surgeon. This accounts for the increasing numbers of health ... state of the art in endoscopic sinussurgery includes many recent innovations. Prob-ably the most fundamental change in sinus surgeryhas been the adaptation of rigid endoscopes for use in the ... sur-gical intervention would include the presence of anatomic abnormalities that could predispose the Rhinitis and Sinusitis Advances in the Surgical Management of Chronic RhinosinusitisErin D....
- 7
- 470
- 0
Báo cáo y học: "Osteoporosis in experimental postmenopausal polyarthritis: the relative contributions of estrogen deficiency and inflammation" potx
... scoring 1 to 3 in each paw (maximum of 12 pointsper mouse) as follows: 1, swelling or erythema in one joint; 2,swelling or erythema in two joints; 3, severe swelling of the entire paw or ankylosis.Tissue ... demonstrated.Phenotypes of bone marrow lymphocytes are influenced both by OVX and by arthritisFlow cytometry analysis was performed to evaluate the effects of OVX and arthritis on phenotypes of bone marrowlymphocytes ... arthritis-induced increased levels of pro-inflammatory cytokines, IgG and CII antibodiesAs shown in Table 1, serum levels of the pro-inflammatorycytokine IL-6 were low in non-arthritic mice in comparison...
- 7
- 361
- 0
Báo cáo y học: " Advances in the genetics of rheumatoid arthritis point to subclassification into distinct disease subsets" pps
... initiallypresent in the small joints of the feet, and appear in the smalljoints of the hands at a later point in the disease course [6].Also, rheumatoid nodules are very rare in the early phases of RA, ... evaluated.Review Advances in the genetics of rheumatoid arthritis point to subclassification into distinct disease subsetsAnnette HM van der Helm-van Mil and Tom WJ HuizingaDepartment of Rheumatology, Leiden ... from genetics to clinicalpractice. In contrast to the recent advances in the field of susceptibility to RA, genetic variants affecting the severity of the disease course in RA are scarcely explored....
- 8
- 412
- 0
Báo cáo y học: "Advances in understanding genome maintenance" pps
... ‘Maintenance of Genome Stability’ is a biennial meeting that brings together, in a fantastic venue, diverse researchers working on how the integrity of genomes is maintained. Topics included ... extremely complex, answers to these questions will undoubtedly uncover many surprises and interesting biology that will be important in advancing our understanding of the role of ubiquitin in genome ... to many signaling proteins, which again highlights the importance of this modification in the DDR. An understanding of how ubiquitylation affects DNA repair and signaling proteins to bring about...
- 3
- 204
- 0
Báo cáo y học: " Infection with hepatitis B virus carrying novel pre-S/S gene mutations in female siblings vaccinated at birth: two case reports" pot
... provided the original work is properly cited. Case report Infection < /b> with < /b> hepatitis < /b> B virus carrying novel pre-S/S gene mutations in female siblings vaccinated at birth: two case reportsMing-Wei Lai1,2, ... progressively. However, about 1 percent of the young generation, who received hepatitis < /b> B vaccination at birth, remain carriers. Infection < /b> with < /b> vaccine-escape hepatitis < /b> B virus mutants always occurs ... needed. Case presentation: Two 19 and 14-year-old Taiwanese female siblings were born to a mother infected with < /b> hepatitis < /b> B virus and received a complete course of hepatitis < /b> B vaccination at birth....
- 5
- 218
- 0
Báo cáo y học: " Decrease in tobacco consumption after treatment with topiramate and aripiprazole: a case report" pot
... reduc-tion. Topiramate is an anticonvulsant and its action mecha-nisms include inhibition of voltage-gated Na+ and Ca+channels and activation of gamma-aminobutyric acid(GABA) receptors, and particularly alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic ... suggest that aripiprazolemay play a role in tobacco control. Aripiprazole has beeninvestigated recently as a treatment for cocaine and alco-hol abuse [9]. It is a partial agonist for the DA D2 ... simultaneously presented with a mild-moder-ate encephalopathy, and so the generalization of this useof topiramate and aripiprazole may not be appropriate.AbbreviationsAMPA: alpha-amino-3-hydroxy-5-methyl-4-isoxazolepro-pionic...
- 3
- 293
- 0
Báo cáo y học: "Seroprevalence of hepatitis B and C virus in HIV-1 and HIV-2 infected Gambians" pps
... S5F2-TATGA TACCCGCTGCTTTGACTCG; HCVNS 5R 2c- CTGG TCA-TAGCCTCCGTGAAGGCTCTCAGG and HCVN S5R2d-CTGGTCATAGCCTCCGTGAAGGCTCGTA GG .Statistical AnalysisHBV seroprevalence was determined in the two ... NS5RnB-TACCTGGTCATAGCCTC CGTGAAG GCTC [41]. G el p uri-fied PCR products were sequenced using primers spe-cific for the 5′ UTR (KF2 - TTCACGCAGAA AGCGTCTAG and 211-CACTCTCGAGCAC CCTAT-CAGGCAGT) and NS 5b (HCVN ... μMofprimersNF5(senseGTGAGGAAC-TACTGTCTTCA CGCAG) and NR5 (antisenseTGCTCATGGTGCACGGTCTACGAGA) was sub-jected to one cycle of < /b> RT at 50 C followed by 30 cycles of < /b> PCR to amplify the 5′UTR region followed by a sec-ond...
- 9
- 474
- 0
Báo cáo y học: " Characterization of Hepatitis B virus (HBV) genotypes in patients from Rondônia, Brazil" doc
... subgenotype of < /b> hepatitis < /b> B virus genotype A in Cameroon but not in neighbouring Nigeria. Clin MicrobiolInfect 2010.20. Bowyer SM, van Staden L, Kew MC, Sim JG: A unique segment of < /b> the hepatitis < /b> B virus ... Railway, ahallmark in Rondônia state history, that was built bymany African-descendants workers in the beginning of< /b> twentieth century. Most of < /b> t hem had come from theCaribbean Barbados in a ... Mushahwar IK,Robertson BH, Locarnini S, Magnius LO: Genetic diversity of < /b> hepatitis < /b> B virus strains derived worldwide: genotypes, subgenotypes, and HBsAgsubtypes. Intervirology 2004,47:289-309.28....
- 7
- 533
- 0
Báo cáo y học: " Concerns regarding hepatitis B vaccination and post-vaccination test among Brazilian dentists" pps
... al., Concerns < /b> regarding < /b> hepatitis < /b> B vaccina-tion and post -vaccination test among Brazilian dentists Virology Journal 2010, 7:154 Resende et al. Virology Journal 2010, 7:154http://www.virologyj.com/content/7/1/154Page ... is properly cited.Research Concerns < /b> regarding < /b> hepatitis < /b> B vaccination and post -vaccination test among Brazilian dentistsVera Lúcia S Resende†1, Mauro Henrique G Abreu†2, Saul M Paiva*†3, ... familyhistory of hepatitis < /b> B and those more recently graduatedhad a greater frequency of self-reported immunizationfor hepatitis < /b> B. As mentioned above, dentists with a morefavourable behaviour...
- 9
- 206
- 0
Báo cáo y học: " Seropositivity of Hepatitis B virus and Hepatitis C virus dual Infection among blood donors in Nyala Teaching Hospital" pot
... serop-ositivity of < /b> dual infection of < /b> HBV and HCV among blood donors in Nyala Teaching Hospital was (0.25%), this per-cent is in accordance with the endemic level of < /b> bothviruses in South Dar ... on the combined effect of < /b> hepatitis < /b> B and C virus infec-tions in causing hepatocellular carcinoma in China. BritishJournal of < /b> Cancer 2005, 92:607-612.12. Crespo J, Lozano JL, de la Cruz F, ... is uncommon in Nyala and may be in the large Sudan due to the endemic level of< /b> both viruses.ConclusionThe study concluded that the seropositivity < /b> of < /b> HBV and HCV dual infection among population...
- 2
- 348
- 0
Báo cáo y học: "Advances in understanding the regulation of apoptosis and mitosis by peroxisome-proliferator activated receptors in pre-clinical models: relevance for human health and disease" potx
... by macrophages and other cell types [99,100]. Therefore, one of the functions of MAP kinase signaling pathway may beto regulate the levels of cytokines or interleukines, therebycontrolling cell mitosis in ... AccessReviewAdvances in understanding the regulation of apoptosis and mitosis by peroxisome-proliferator activated receptors in pre-clinical models: relevance for human health and diseaseEric ... protein, and the fatty acid translocase [53]. Recently, the idea of a link between PPARγ and the insulin signalinghas been reinforced by the finding that the c-Cbl-associat-ed protein, a signaling...
- 15
- 437
- 0
Báo cáo y học: " Advances in the genetics and epigenetics of gene regulation and human disease" pps
... asso-ciated with the cyclin/cyclin-dependent kinase pathway wasidentified. The combination of RNAi and gene- expression profiling pro-vides further insight into gene function and the regulatorynetworks ... Using flow cytometry, Björklund and col-leagues analyzed the RNAi-induced loss -of- function of 70% of the genes in Drosophila, including those conserved in humans, on cell-cycle progression by ... that are generally affected by chemotherapy and radiation therapy. Using various statistical approaches, the genetic association between SNPs in genes involved in the ROS pathways and the expression...
- 3
- 265
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Chuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM