Báo cáo toán học: "Differential display identifies overexpression of the USP36 gene, encoding a deubiquitinating enzyme, in ovarian cancer" pot

... ggatccatttaggtgacactatagaagtacctgaaaggaagcttttttttttcg aggatttcctgtatttattaagttacaagttggcaggcacagcttgagcaacat agaaaagtaatcttcttgagttatacaatcatttaaattccaaagcactcacaa aattgagcaaacaaagccactatttgcatatttgggaaaggaaacatattgct aacgtaagcttcctgaatccttcatggcctatagtgagtcgtattagaattc-3’ ). The synthesized riboprobe was precipitated by ... measured by liquid scintillation analysis. The probe for USP...

Ngày tải lên: 08/08/2014, 17:20

... provided all interpretations of the chemical raw data. All authors read and approved the final manuscript. Acknowledgements Part of this work was presented at the 111th Annual General Meeting of the ... Furthermore, a FQ-resistant strain of E. coli, isolated from sewage sludge, contained the aminoglycoside transacetylase gene aac(6’)-Ib-cr and was capable of modifyin...

Ngày tải lên: 20/06/2014, 21:20

...

Ngày tải lên: 05/08/2014, 10:20

... application of the table. While inves- tigating a problem arising from cellular radio, Mira Bernstein, Paul Wright and I were led to consider the number of sublattices of index n of the planar ... version available also as a book [2] and as part of a Maple package (probably prepared by Simon Plouffe and myself in collaboration with Bruno Salvy). Each of the three ve...

Ngày tải lên: 07/08/2014, 06:20

... the probability that two fixed edges (a i ,a j )and (a k ,a l ) are D π -bad. Consider first the case where (a i ,a j )and (a k ,a l ) share an endpoint, say a k = a i .Sinceπis random, the probability that ... 6 Indeed, i(jh+h 3 )+  i 2  (h−2)≤(h−1)(h 7 +h 3 )+  h−1 2  (h−2)<h 8 −(h−1)≤n−i. OurconstructionofQshowsthatafteraddingtheK h subgraphinducedby{q 1 , ,q h }...

Ngày tải lên: 07/08/2014, 06:20

... point x of PG(5, 3), define the generating index i K (x) of x as the minimal number of points of K which are necessary to generate a subspace containing x. Lemma 4.1 ([4], [8]) (a) The maximal index ... is a point and a near 2-gon is a line. Near quadrangles are usually called generalized quadrangles (Payne and Thas [11]). If X 1 and X 2 are two nonempty sets of points...

Ngày tải lên: 07/08/2014, 21:21

... mean value of 0.10 whereas the transmit- tance ranged between 0.03 and 0.16 around a mean value of 0.07. The variability of leaf transmittance was more marked at the top and the bottom than in the ... multidirectional origin of the scattered radiation is taken into account. The assumption is made that leaves and the soil surface are lambertian diffusers. For leaf a...

Ngày tải lên: 08/08/2014, 14:22

... GATA-4, present in GT1 cells, can interact with the GATA- binding motifs. Later, Lawson et al. also reported the binding of two GATA factors, GBF -A1 ⁄ A2 and GBF-B1, to the GATA factor-binding sites in the GnRH-I ... cells located throughout the basal hypothalamus of the brain, and is released into the hypothalamo-hypophyseal portal circulation in a pulsatile manne...

Ngày tải lên: 16/03/2014, 04:20

... that the main contamination, seen in lane 1, run s only m arginally above the hA2aR fusion pro tein and is the main band in lane 2. In this pu ri®cation, 7% of speci®c ligand binding sites loaded ... hA2aR (M -A2 aTr316-H10) binds speci®cally and quantitatively to a XAC-agarose gel. Shown is a section of a 10% silver-stained SDS/PAGE gel. Lane 1 , 0.4 lgofthe fraction lo...

Ngày tải lên: 24/03/2014, 00:21

... -GTGAACTGGGGGAGG ATTGT-3’ and reverse 5’-GGAGAAATCAAACAGAGGCC-3’ ; GAPDH forward 5’-CCAAGGTCATCCATGACAAC-3’ and reverse 5’ -TTACTCCTTGGAGGCCATGT-3’ . Reactions were performed in duplicate from two sepa- rate ... monoclonal ab, Dako Carpinteria, CA, USA), diluted 1:100. The conventional avidin-biotin complex pro- cedure was applied according to the manufacturer’sproto- col (Dako Carpinte...

Ngày tải lên: 18/06/2014, 22:20