... et al. 64 11, 32]. Similarly, allozyme surveys have shown that geographically restricted species that are locally abun- dant contain fewer polymorphic loci and a lower mean number of alleles ... north of France (group 1). In addition, allele b of AAP was absent in group 5 and allele b of SKDH was absent from group 1. The mean number of alleles per group (table III) varied very l...
Ngày tải lên: 08/08/2014, 14:21
... deer samples from Scotland were 19fwd (5’ ATT TTG CAG ATA AGT CAT C 3’), 778rev (5’ AGA AGA TAA TGA AAA CAG GAA G 3’) and 315fwd (5’ CAG TAA ACC AAA AAC CAA C 3’). A detailed description of ... Simone Peletto et al. Tabl e 2 . Allele frequencies of the PRNP polymorphisms in red deer from Italy and Scotland Allele frequency (%) Cervus Cervus Codon Allele elaphus elaphus elaphus sco...
Ngày tải lên: 07/08/2014, 23:22
Báo cáo khoa hoc:"Genetic parameters of a random regression model for daily feed intake of performance tested French Landrace and Large White growing pigs" pptx
... weekly means of daily feed intake are slightly lower than the values found by Von Felde et al. [25]. Heritability estimates of Hall et al. [11] for four biweekly means of daily feed intake lay ... sequence relative to coupled chains. For all graphical analysis of Gibbs chains the statistical software package S-Plus [18] was used. Effective sample size [23] of samples after burn-in w...
Ngày tải lên: 09/08/2014, 18:21
Báo cáo khoa học: "The humus of a "Parabraunerde" (Orthic Luvisol) under Fagus sylvatica L and Quercus robur L and its modification in 25 years" docx
... of an L- and an Oh-layer. The Of- layer has become tangled and lami- nated. The pH has decreased by half a unit. The translocation of fulvic acids has increased and ... acidification. MATERIALS AND METHODS A loamy Orthic Luvisol (Typische Parabrau- nerde, Typic Hapludalf, Sol brun lessivé) formed in the Weichselian boulder marl over fluvio...
Ngày tải lên: 08/08/2014, 23:22
Báo cáo khoa học: "Genetic determination of vessel area in oak (Quercus robur L and Q petraea Liebl): a characteristic related to the occurrence of stem shakes" docx
... individual j of genotype or family i, μ is the overall Original article Genetic determination of vessel area in oak (Quercus robur L and Q petraea Liebl): a characteristic ... material collected from a half-sib progeny trial, also located in Bramwald Forest near Kassel in Lower Saxony, Germany. The experiment, established in 1950, consi...
Ngày tải lên: 08/08/2014, 19:21
Báo cáo khoa hoc:" Genetic components of litter size variability in sheep" potx
... of litter size variability in sheep Magali S AN C RISTOBAL -G AUDY a, ∗ ,LoysB ODIN b , Jean-Michel E LSEN b , Claude C HEVALET a a Laboratoire de génétique cellulaire, Institut national de la ... approach was compared with more traditional methods. 2. GENETIC MODEL 2.1. Threshold model for polytomous data – Likelihood approach AsGianolaand Foulley[10], Foulley andGianola [8]orSanCrist...
Ngày tải lên: 09/08/2014, 18:21
báo cáo khoa học: "Genetic variation of g-tocopherol methyltransferase gene contributes to elevated a-tocopherol content in soybean seeds" pdf
... CACGAATGTGAATTTGATCG Reverse CGACCAAGGAGATAAAAACAGA KSC138-17 Forward TGGAAATTCTGTGCACTTGGTG Reverse TAAAGCCGCCTAGCCGATTG KSC138-22 Forward TGCAGCAATAATCAATCAAATAGAA Reverse TTCAATCAAATTTAGCACGTGTATT KSC138-23 ... Forward CTGGAGGCAGAGTATAGCG Reverse AAACTCCCAGGTCCCACCCAAT g-TMT2 Forward GAAGCAAGTTTCCAACAGGTCG Reverse CGCCAATCATAGGAGATATTGCATATG g-TMT3 Forward CAGTGGACTTAAAACCATAAAGGGAGC Rever...
Ngày tải lên: 11/08/2014, 11:21
báo cáo khoa học: " Genetic control of mammalian T-cell proliferation with a synthetic RNA regulatory system - illusion or reality?" pps
... to attack malignant cells (or any other types of abnormal cells) that escape the body’s natural surveillance by using T cells that have a natural or genetically engineered reactivity to a patient’s ... enhancing the persistence of transferred T cells include ablation of all white blood cells (myeloablative methods), such as total body irradiation and administration of toxic...
Ngày tải lên: 11/08/2014, 12:21
báo cáo khoa học: " Genetic mapping of wild introgressions into cultivated peanut: a way toward enlarging the genetic basis of a recent allotetraploid" docx
... Brazil Email: Daniel Foncéka - daniel.fonceka@cirad.fr; Tossim Hodo-Abalo - aristossim@yahoo.fr; Ronan Rivallan - ronan.rivallan@cirad.fr; Issa Faye - issafaye2001@yahoo.fr; Mbaye Ndoye Sall - ... (A. duranen- sis V14167 diploid AA and A. ipaënsis KG30076 diploid BB), a tetraploid AABB amphidiploid (A. ipaënsis × A. duranensis) 4X , hereafter called AiAd and a cultivated tetra- ploid...
Ngày tải lên: 12/08/2014, 03:21