Báo cáo khoa học: "Genetic variability of a scattered temperate forest tree: Sorbus torminalis L (Crantz)" ppsx

... et al. 64 11, 32]. Similarly, allozyme surveys have shown that geographically restricted species that are locally abun- dant contain fewer polymorphic loci and a lower mean number of alleles ... north of France (group 1). In addition, allele b of AAP was absent in group 5 and allele b of SKDH was absent from group 1. The mean number of alleles per group (table III) varied very l...

Ngày tải lên: 08/08/2014, 14:21

... deer samples from Scotland were 19fwd (5’ ATT TTG CAG ATA AGT CAT C 3’), 778rev (5’ AGA AGA TAA TGA AAA CAG GAA G 3’) and 315fwd (5’ CAG TAA ACC AAA AAC CAA C 3’). A detailed description of ... Simone Peletto et al. Tabl e 2 . Allele frequencies of the PRNP polymorphisms in red deer from Italy and Scotland Allele frequency (%) Cervus Cervus Codon Allele elaphus elaphus elaphus sco...

Ngày tải lên: 07/08/2014, 23:22

... weekly means of daily feed intake are slightly lower than the values found by Von Felde et al. [25]. Heritability estimates of Hall et al. [11] for four biweekly means of daily feed intake lay ... sequence relative to coupled chains. For all graphical analysis of Gibbs chains the statistical software package S-Plus [18] was used. Effective sample size [23] of samples after burn-in w...

Ngày tải lên: 09/08/2014, 18:21

Ngày tải lên: 09/08/2014, 18:21

... of an L- and an Oh-layer. The Of- layer has become tangled and lami- nated. The pH has decreased by half a unit. The translocation of fulvic acids has increased and ... acidification. MATERIALS AND METHODS A loamy Orthic Luvisol (Typische Parabrau- nerde, Typic Hapludalf, Sol brun lessivé) formed in the Weichselian boulder marl over fluvio...

Ngày tải lên: 08/08/2014, 23:22

... individual j of genotype or family i, μ is the overall Original article Genetic determination of vessel area in oak (Quercus robur L and Q petraea Liebl): a characteristic ... material collected from a half-sib progeny trial, also located in Bramwald Forest near Kassel in Lower Saxony, Germany. The experiment, established in 1950, consi...

Ngày tải lên: 08/08/2014, 19:21

... of litter size variability in sheep Magali S AN C RISTOBAL -G AUDY a, ∗ ,LoysB ODIN b , Jean-Michel E LSEN b , Claude C HEVALET a a Laboratoire de génétique cellulaire, Institut national de la ... approach was compared with more traditional methods. 2. GENETIC MODEL 2.1. Threshold model for polytomous data – Likelihood approach AsGianolaand Foulley[10], Foulley andGianola [8]orSanCrist...

Ngày tải lên: 09/08/2014, 18:21

... CACGAATGTGAATTTGATCG Reverse CGACCAAGGAGATAAAAACAGA KSC138-17 Forward TGGAAATTCTGTGCACTTGGTG Reverse TAAAGCCGCCTAGCCGATTG KSC138-22 Forward TGCAGCAATAATCAATCAAATAGAA Reverse TTCAATCAAATTTAGCACGTGTATT KSC138-23 ... Forward CTGGAGGCAGAGTATAGCG Reverse AAACTCCCAGGTCCCACCCAAT g-TMT2 Forward GAAGCAAGTTTCCAACAGGTCG Reverse CGCCAATCATAGGAGATATTGCATATG g-TMT3 Forward CAGTGGACTTAAAACCATAAAGGGAGC Rever...

Ngày tải lên: 11/08/2014, 11:21

... to attack malignant cells (or any other types of abnormal cells) that escape the body’s natural surveillance by using T cells that have a natural or genetically engineered reactivity to a patient’s ... enhancing the persistence of transferred T cells include ablation of all white blood cells (myeloablative methods), such as total body irradiation and administration of toxic...

Ngày tải lên: 11/08/2014, 12:21

... Brazil Email: Daniel Foncéka - daniel.fonceka@cirad.fr; Tossim Hodo-Abalo - aristossim@yahoo.fr; Ronan Rivallan - ronan.rivallan@cirad.fr; Issa Faye - issafaye2001@yahoo.fr; Mbaye Ndoye Sall - ... (A. duranen- sis V14167 diploid AA and A. ipaënsis KG30076 diploid BB), a tetraploid AABB amphidiploid (A. ipaënsis × A. duranensis) 4X , hereafter called AiAd and a cultivated tetra- ploid...

Ngày tải lên: 12/08/2014, 03:21