... 4 ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT DENV-3 104 382 279 1G5P30 Group 5 TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT DENV-4 9903 10318 415 C. Gijavanekar et al. PCR detection of nearly any dengue ... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA DENV-1 92.1 ± 0.57 73.6 ± 2.31 1G4P217 ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT DENV-3 90.3 ± 1.09 83.9 ± 5.16 1G5P30 TTCCAACAAGCAGAACAACAT...
Ngày tải lên: 14/02/2014, 19:20
... control was maintained in a standard incubator with 21% O 2 . The normoxia data are the same as shown in Fig. 1 and are included here for comparison. Expression of miR-2 7a and miR-27b at the indicated ... overexpression, indicating that miR-27 does not play an important role in myogenic differentiation. Taken together, these results illustrate a critical and specific r...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Reversible tetramerization of human TK1 to the high catalytic efficient form is induced by pyrophosphate, in addition to tripolyphosphates, or high enzyme concentration ppt
... 2008 FEBS 577 Reversible tetramerization of human TK1 to the high catalytic efficient form is induced by pyrophosphate, in addition to tripolyphosphates, or high enzyme concentration Birgitte Munch-Petersen Department ... to human TK1. In the first crystal structure of TK1- type enzymes of human and myco- plasmic origin [14], the...
Ngày tải lên: 18/02/2014, 12:20
Tài liệu Báo cáo khoa học: "Automatic Collection of Related Terms from the Web" pptx
... collected 610 terms in total; the average number of output terms per input is 12.2 terms. We checked whether each of the 610 terms is a correct related term of the original seed term by hand. The result ... indidates that the term passed the test. Twenty terms out of the thrity candidate terms passed the first techinical-term test (Tech.) and six- teen ter...
Ngày tải lên: 20/02/2014, 16:20
Báo cáo khoa học: Dual modulation of prothrombin activation by the cyclopentapeptide plactin pptx
... the N-terminus of its B-chain [19]. The sequential mechanism leading to enhancement of scu-PA activation is shown in Fig. 3F. Dual modulation of prothrombin activation by plactin The above results ... (Fig. 4). These properties of the plactin prothrombin interaction suggested a change in the conformation of prothrombin after plactin bind- ing. We measur...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: Increased susceptibility of b-glucosidase from the hyperthermophile Pyrococcus furiosus to thermal inactivation at higher pressures pptx
... be a cause of inactivation at higher pressures. No dissociation into subunits was observed. One similar example from the literature showed that inactivation of the dimeric almond b-glucosidase ... result of unfolding, dissociation or aggregation of the intact enzyme [16]. Influence of temperature on enzyme inactivation by pressure treatment The influence of te...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: Quantitative assessment of the glyoxalase pathway in Leishmania infantum as a therapeutic target by modelling and computer simulation pot
... FEBS Quantitative assessment of the glyoxalase pathway in Leishmania infantum as a therapeutic target by modelling and computer simulation Marta Sousa Silva 1 , Anto ´ nio E. N. Ferreira 1 , Ana ... evaluating the relevance of the glyoxalase pathway as a potential therapeutic target by revealing the importance of critical parameters...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: "Automatic Assessment of Coverage Quality in Intelligence Reports" doc
... devel- oping computational methods for deep as- sessment of quality in the domain of intel- ligence reports. We present an automated system for ranking intelligence reports with regard to coverage of ... Linguistics Automatic Assessment of Coverage Quality in Intelligence Reports Samuel Brody School of Communication and Information Rutgers University sdbrody@gmail....
Ngày tải lên: 23/03/2014, 16:20
Báo cáo khoa học: "Commercial delivery of genetic improvement to conifer plantations using somatic embryogenesi" pps
... B. SuttonCommercial delivery of genetic improvement Original article Commercial delivery of genetic improvement to conifer plantations using somatic embryogenesis Ben Sutton * CellFor ... with delivery to forestry nurseries, the ability to dry and store the embryos is critical. Storage allows continuous embryo production and the accu- mulation of sufficientin...
Ngày tải lên: 08/08/2014, 14:20
Báo cáo khoa học: "Allozyme assessment of genetic diversity within the relic Sicilian fir Abies nebrodensis (Lojac.) Mattei" ppt
... relaunching the dynam- ics of the fir population as recommended by Ciancio et Original article Allozyme assessment of genetic diversity within the relic Sicilian fir Abies nebrodensis ... validates the choice of these populations as a refer- ence system in assessing the genetic diversity within A. nebrodensis. 2) In a general...
Ngày tải lên: 08/08/2014, 14:21
Báo cáo khoa học: "An assessment of edge effect on growth and timber external quality of ayous (Triplochiton scleroxylon K Schum) under Cameroon rain forest conditions" docx
... of edge effect on growth and timber external quality of ayous (Triplochiton scleroxylon K Schum) under Cameroon rain forest conditions TB Mayaka JN Fonweban Z Tchanou P Lontchui 1 ... An investigation was conducted in order to assess the edge effect on growth characteristics and timber external quality of ayous (Tripl...
Ngày tải lên: 08/08/2014, 19:21
Báo cáo khoa học: "Quantitative assessment of inter-observer variability in target volume delineation on stereotactic radiotherapy treatment for pituitary adenoma and meningioma near optic tract" pot
... inter-observer variability in contour delineation and their influences on planning for pituitary adenoma and meningioma near optic tract. Background Target delineation is an important issue in ... Quantitative assessment of inter- observer variability in target volume delineation on stereotactic radiotherapy treatment for pituitary ad...
Ngày tải lên: 09/08/2014, 09:20
Báo cáo khoa học: "Technology Assessment of Automated Atlas Based Segmentation in Prostate Bed Contouring" pptx
... contours created by atlas- based segmentation engines in the contex t of segmenta- tion of post-prostatectomy radiotherapy planning CT datasets. In the context of this study, only 12% of the unedited ... 6:110 http://www.ro-journal.com/content/6/1/110 Page 9 of 9 Enrollment, N = 75 Patient Index Patient, n = 1 Input Into Atlas N = n+1 Atlas Builder (AB) Manually Con...
Ngày tải lên: 09/08/2014, 09:21
Báo cáo khoa hoc:" Objective assessment of motor fatigue in multiple sclerosis using kinematic gait analysis: a pilot study" pot
... upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. Objective assessment of motor fatigue in multiple sclerosis using kinematic gait analysis: a pilot ... obtaining meaningful data on a patient’s physical status and may be particularly valuable for assessing a patient’s ability to perform occupational tasks and cons...
Ngày tải lên: 11/08/2014, 07:21
Báo cáo khoa học: " An assessment of the RIFLE criteria for acute renal failure in critically ill HIV-infected patients" docx
... (HAART), comorbidity, and severity of illness. In all cases, maximum RIFLE occurred within the first week of hospitalization. Letter An assessment of the RIFLE criteria for acute renal failure in critically ill HIV-infected ... creatinine above the baseline serum creatinine level. When the baseline serum creatinine is unknown and there is no past hist...
Ngày tải lên: 13/08/2014, 03:20