Báo cáo khoa học: "Above- and belowground phytomass and carbon storage in a Belgian Scots pine stand" docx

Báo cáo khoa học: "Above- and belowground phytomass and carbon storage in a Belgian Scots pine stand" docx

Báo cáo khoa học: "Above- and belowground phytomass and carbon storage in a Belgian Scots pine stand" docx

... con- tained 26.8 t·ha -1 , representing 11 % of the C accumulat- ed in the stand (figure 4). Original article Above- and belowground phytomass and carbon storage in a Belgian ... C storage in the phytomass. 4. DISCUSSION Stand age and site quality clearly determine the total amount of Scots pine phytomass [43, 47], as well as t...

Ngày tải lên: 08/08/2014, 14:21

10 93 0
Báo cáo khoa học: "Effects of sylvicultural practices on nutrient status in a Pinus radiata plantation: Nutrient export by tree removal and nutrient dynamics in decomposing logging residues" ppt

Báo cáo khoa học: "Effects of sylvicultural practices on nutrient status in a Pinus radiata plantation: Nutrient export by tree removal and nutrient dynamics in decomposing logging residues" ppt

... Changes in absolute amount of elements with time for radiata pine slash needles and twigs incu- bated in the thinned stand and in the prepared and unprepared plots after clear-felling. Original ... logging residue manage- ment on decomposition rates and nutrient dynamics in decaying logging residues was monitored for one year in a thinned stand and in an adjacent cle...

Ngày tải lên: 08/08/2014, 14:21

12 266 0
Tài liệu Báo cáo khoa học: "Know When to Hold''''Em: Shuffling Deterministically in a Parser for Non concatenative Grammars*" pdf

Tài liệu Báo cáo khoa học: "Know When to Hold''''Em: Shuffling Deterministically in a Parser for Non concatenative Grammars*" pdf

... advantage of the information that a semantic head provides. For example, a head usually provides information about the remaining daughters that the parser must find, and (since the head daughter ... (1979) wrapping oper- ations, Pollard's (1984) head-wrapping operations, and Moortgat's (1996) extraction and infixation op- erations in (categorial) type-logical gramma...

Ngày tải lên: 20/02/2014, 18:20

7 397 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

... 32] ISS hnRNP A1 UAGUGAAUAGAGUUAGGCAGGGA 7928–7950 ESE3 ASF ⁄ SF2 GAAGAAGAA 8016–8025 hnRNP A1 UAGAAGAAGAA 8018–8025 HIV-1 alternative splicing regulation J. Tazi et al. 872 FEBS Journal 277 (2010) ... 869 MINIREVIEW Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action Jamal Tazi 1 , Nadia Bakkour 1 , Virginie Marchand 2 , Lilia Ayadi 2 , Amina Aboufi...

Ngày tải lên: 06/03/2014, 09:22

10 434 0
Báo cáo khoa học: "Identification of Domain-Specific Senses in a Machine-Readable Dictionary" potx

Báo cáo khoa học: "Identification of Domain-Specific Senses in a Machine-Readable Dictionary" potx

... training and the remaining 90% for test data. The training data is used to estimate K according to rank score, and test data is used to test the method using the estimated value K. We man- ually ... WordNet. In In Proc. of LREC-2000. Y. Matsumoto, A. Kitauchi, T. Yamashita, Y. Hirano, Y. Matsuda, K. Takaoka, and M. Asahara. 2000. Japanese Morphological Analysis System ChaSen Version...

Ngày tải lên: 30/03/2014, 21:20

6 312 0
Báo cáo khoa học: " Acupuncture treatment for idiopathic Horner''''s syndrome in a dog" doc

Báo cáo khoa học: " Acupuncture treatment for idiopathic Horner''''s syndrome in a dog" doc

... enophthalmos, and prolapsed nictitans for 2 days following sudden onset. According to history taking, ophthalmic, neurological, and radiological examination, the patient was diagnosed with idiopathic ... was alert during the examination. Other signs were not found after neurological and otoscopic examination, and complete blood counts, serum protein, and urine analysis were...

Ngày tải lên: 07/08/2014, 20:23

3 387 0
Tài liệu Báo cáo khoa học: How to remain nonfolded and pliable: the linkers in modular a-amylases as a case study ppt

Tài liệu Báo cáo khoa học: How to remain nonfolded and pliable: the linkers in modular a-amylases as a case study ppt

... the participating Table 1. Amino acid frequencies (%) in a- amylase linkers, in a set of globular proteins, in the Swiss-Prot databank and in intrinsically unstructured proteins. Amino acid Linkers a Globular proteins b Swiss-Prot c Intrinsically unstructured proteins b Ala ... function in activity, substrate binding and structural dynamics. Materials and methods Experime...

Ngày tải lên: 14/02/2014, 18:20

8 625 0
Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx

Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx

... kinase, 60S acidic ribosomal protein P2 (RPLP2), eukaryotic initiation factor 5A (eIF 5A) , parathymosin, L7 ⁄L12, annexin A2 , annexin A5 , aldolase A, fascin 1 and peroxyredoxin 1] displayed quantitative ... pathogenesis Tiziana Alberio 1 , Alessandra Maria Bossi 2 , Alberto Milli 2 , Elisa Parma 1 , Marzia Bruna Gariboldi 1 , Giovanna Tosi 3 , Leonardo Lopiano 4 and Mauro Fasano 1...

Ngày tải lên: 15/02/2014, 01:20

11 776 0
Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

... Ewing’s sarcoma (EWS) oncogene contains an N-terminal transcrip- tion activation domain and a C-terminal RNA-binding domain. Although the EWS activation domain is a potent transactivation domain ... forward d(CGG AAT TCA TGG CGT CCA CGG ATT ACA G) and EAD reverse d(CGC TCG AGT CAT CCG GAA AAT CCT CCA GAC T), for pGEX–EAD; RGG1 forward d(CGG AAT TCC CAG GAG AGA ACC GGA GCA T) and RGG...

Ngày tải lên: 15/02/2014, 01:20

11 787 0
Từ khóa:
w