Báo cáo khoa học: "Leaf gas exchange and carbohydrate concentrations in Pinus pinaster plants subjected to elevated CO 2 and a soil drying cycle" doc

... carbohydrate concentrations in Pinus pinaster plants subjected to elevated CO 2 and a soil drying cycle Catherine Picon-Cochard Jean-Marc Guehl Unité de recherches en écophysiologie ... the CO 2 assimilation rate and needle starch concentration all along the soil drying cycle in P. pinaster. However, in this drought-avoiding Note...

Ngày tải lên: 08/08/2014, 14:21

... total leaf length and actual plant leaf area were estab- lished. A unique relationship was obtained for all the experimental treatments and dates: Plant leaf area (cm 2) ... in biomass growth and in plant leaf area was brought about by the elevated [CO 2 ]. Transpiration rate was lower in the elevated [CO 2] conditions, but whole...

Ngày tải lên: 08/08/2014, 18:21

... 2 leaves per tree. Gas exchange parameters were calculated on a leaf area basis. Leaf area was determined in situ just prior to the gas exchange measure- ments by means ... reduction may be accompa- nied by a decrease in stomatal conduc- tance and in transpirational water losses which can be beneficial for the plant water status an...

Ngày tải lên: 08/08/2014, 23:22

... 4.0 T2–Cl 3.0 – 2. 5 2. 6 2. 9 2. 8 2. 5 2. 5 T3–O1 2. 6 2. 5 2. 2 2. 3 – – 2. 0 2. 2 T3–O2 2. 7 2. 6 2. 5 2. 5 2. 7 2. 4 2. 5 2. 3 T3¢–O1 2. 7 2. 9 2. 6 2. 7 – – 2. 7 2. 6 T3¢–O2 2. 5 2. 7 2. 3 2. 3 2. 3 2. 5 2. 5 2. 5 T2–O2 2. 7 ... laccase was fraction- ated into two separate pools: pool 1, containing the more heavily overglycosylated laccase; and pool...

Ngày tải lên: 16/03/2014, 00:20

... equivalent from one tree to another. 3.3. Stand level foliage area The stand LAI was calculated by dividing the stand foliage area by the stand area. For the 21 and 26 year-old stands, stand foliage ... phenomena. First, branch foliage was not only relat- ed to branch characteristics but also to trees and stands Table V. Summary of the stands characteristics and LAI (leaf area i...

Ngày tải lên: 08/08/2014, 14:21

... The acidic chains are diantennary, triantennary and tetraantennary, fucosylated complex-type chains with a tandem N-acetyllactosamine repeat in the nonreducing regions to which the main sialic acids ... (peak a at 19 min, peak b at 34 min and peakcat38min)arefragmentsofZPA.Thatis, Fig. 1. Reverse-phase HPLC of N-glycopep- tides retained to LCA and ConA agarose. Reduced and c...

Ngày tải lên: 21/02/2014, 03:20

... định bởi: 2 th 2 RIN 2 spsp 2 sps 2 sh ,,,, ;IPG B B 2) ;IPG(eB2 ASEtx 2 21 0 e 2 spsASEtx12e 2 sh =+= , R kTB4 ;)GI(RIN); 2 B B(I B B e 2 th 2 S 2 RIN e 0 2 ASE 0 e 2 2 2 spsp === ... EDFA đợc dùng làm BA là: R e kTB4 e B 2 P) 2 B B(I B B IPG B B 2) IPG(eB2 )PG(m5,0 )1M(3 1M CNR )G(RIN tx2 e 0 2 ASE 2 0 e 2 2ASEtx 2 2 1 0 e ASEtx2e 2...

Ngày tải lên: 06/08/2014, 05:20

... as in South Africa, New Zealand and Australia, where it was introduced between 1940–1950. According to Hopkins and Butcher [23 ], in Western Australia alone, 30 000 ha of this species had already ... relative contribution of genetic and environmental factors in the variation of aver - age ring density, and its components, and evaluating some implications for tree breeding....

Ngày tải lên: 08/08/2014, 14:20

... the following sequences: PhiC: 5¢-CGATACGCTCAAAGTCA AAATAATCAGCGTGACATTCAGAAGGGTAATAAG AACG-3¢;, PhiW: 5¢-CGTTCTTATTACCCTTCTGAA TGTCACGCTGATTATTTTGACTTTGAGCGTATCG-3¢ and M13C: 5¢-CTACAACGCCTGTAGCATTCCACAGA CAGCCCTCATAGTTAGCGTAACGAGATCG-3¢. ... of single-strand DNA (ssDNA) and assimilation of ssDNA into homologous super-coiled duplex DNA. J Biol Chem 27 6, 41906–419 12. 10 Nara T, Hamada...

Ngày tải lên: 19/02/2014, 07:20

... Forestry Commisssion and INRA for assistance in labelling, mapping trees, and measuring leaf morphology, to Tom Connolly for statistical advice during the comparative analysis of data sets, and to ... synthetic variables of CDA); C and D: principal component analysis (PCA1 and PCA2 are the first two synthetic variables of PCA); E and F: multiple correspondence analysis (MCA1...

Ngày tải lên: 08/08/2014, 14:21