Báo cáo khoa học: "Stemflow and throughfall determination in a resprouted Mediterranean holm-oak forest" pps

... pathways in the canopy, the correlation coefficient between THF, STF and INT and some parameters of rainfall events (maximum and average rainfall inten- sity, storm duration ... stemflow and infiltration [9, 10, 26]. The aim of this paper is to analyze the rainfall partitioning between throughfall, stemflow and interception in a Mediter- ra...

Ngày tải lên: 08/08/2014, 14:21

... linguistic information will be available to address derivation/compounding. Since the nec- essary generative capacity is available in the syntac- tic grammar anyway, it seems reasonable to leave more ... con- taining prefixes. From these 100 forms, we gen- erated about 3700 grammatical and ungrammatical test examples by omission, addition and permutation of stems and affixes. After maki...

Ngày tải lên: 23/03/2014, 19:20

... "the' and "bucket' for (1, 'bury', 'the' and 'hatchet' for ¢2, and 'take', 'into' and 'account' for ,t3. The idiomatic ... handled in a 'lexJcalized' formalism such as Tree Adjoining Grammar. The extended domain of locality of TAGs also allows one to 'lexicalize' syntactic rule...

Ngày tải lên: 31/03/2014, 18:20

... paper patterns of hybridization and of the mating system of Q petraea and Q robur have been inferred from examination of allo- zyme variation in 2 cohorts of a stand comprised ... (1991) and Zanetto et al (1993). We stained and then scored 8 enzyme systems encoded by 8 putative loci: acid phosphatase (ACP), glutamate-oxalacetate transaminas...

Ngày tải lên: 08/08/2014, 19:21

... Tempe, AZ, USA 4 Institut Pasteur of Shanghai, Chinese Academy of Sciences, Shanghai, China Optically pure d-orl-amino acids are used as inter- mediates in several industries. d-amino acids are involved ... high catalytic activity. In this study, an approach combining genomic database mining and activity screening was utilized. First, all putative enzymes that were predicted to have hyd...

Ngày tải lên: 18/02/2014, 08:20

... enterica Typhimurum strain IFO12529 genomic DNA as the template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing ... an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG TGCCAACTCCCAC) containing a BamHI site. The gene was cloned at the NheI and BamHI sites of the pRSET-C vec- tor (Invitrogen,...

Ngày tải lên: 18/02/2014, 14:20

... Kpn1 and Nco1 sites using a forward oligomer 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢. For derivitization ... oligomers 5¢-GGCGGGAGGGGCGATAATTTTATCGCGTTAAAA CCG-3¢ (forward) and 5¢-CGGTTTTAACGCGATAAAAT TATCGCCCCTCCCGCC-3¢ (reverse). Virus amplification was performed in monolayer SF21 cells, and...

Ngày tải lên: 19/02/2014, 06:20

... improve machine translation performance on patents is to enlarge the training set to include all available data. This question has been investigated by Tins- ley et al. (2010) and Utiyama and Isahara ... combination is accomplished by adding additional language model and translation model features to the log-linear model and tuning the additional meta-parameters by standard mini- mum...

Ngày tải lên: 22/02/2014, 03:20

... 495 amino acids are considered to constitute the lac1 mature protein giving a calculated molecular mass of 53 212 Da. Two putative polyadenylation signals (TATAAA and CATAAA) were identified near ... °Cfor20s,52°Cfor20s and 70 °C for 2 min; then a final extension at 72 °C for 10 min. The primers for lac1 P LAC1F (5¢-AGCTTT CATTCCCAGTGATTG-3¢)andP LAC1R (5¢-AACGAG CTCAAGTACAAATGACT-3¢) w...

Ngày tải lên: 07/03/2014, 15:20

... C1 and C2 domains appeared to be joined by a ‘linker’ sequence. Also boxed are the transmembrane domain and the serine ⁄ threonine kinase domain. A. Herpin et al. BMP/activin pathway in Crassostrea ... target). Zebrafish maintenance and preparation of eggs TAB zebrafish were reared and maintained on a light ⁄ dark cycle essentially as described by Westerfield [49]. All experi- men...

Ngày tải lên: 07/03/2014, 21:20