Báo cáo khoa học: "Carbon-based models of individual tree growth: A critical appraisal" ppsx

... accurate representation of the actual location and topological characteristics of tree organs. An impor- tant feature of compartmental models is that they cannot assign resource acquisition to a ... when suitably parameterised. To a certain extent, all these models can be viewed as mechanistic models of tree growth that formulate rates of change in several state variab...

Ngày tải lên: 08/08/2014, 14:21

... JC, Paul SM & Holtzman DM (2001) Peripheral anti -A beta antibody alters CNS and plasma A beta clearance and decreases brain A beta burden in a mouse model of Alzheimer’s disease. Proc Natl Acad ... Meyer-Luehmann M, Spires-Jones TL, Prada C, Garcia-Alloza M, de Calignon A, Rozkalne A, Koenigsknecht-Talboo J, Holtzman DM, Bacskai BJ et al. (2008) Rapid appearance and local tox...

Ngày tải lên: 16/02/2014, 09:20

... SynchUVG-DL can be used to synchronize a syn- tactic grammar for these languages either with a se- mantic grammar, or with the syntactic grammar of another language for machine translation applica- ... International sur les Grammaires d'Arbres Adjoints (TAG+3), Rapport Technique TALANA-RT-94-01. Universit~ Paris 7. Kaplan, Ronald M. and Martin Kay. 1994. Regular models of...

Ngày tải lên: 31/03/2014, 06:20

... model in at least two ways: either as a main factor, as in analysis of vari- ance (ANOVA), or within an interaction term when asso- ciated with another cofactor, such as ring width or cambial age. ... effect of each of these possi- bilities with the same tool of F ratio. Analyses of variance were conducted using the aov (analysis of variance) procedure of Splus (Type I sum of...

Ngày tải lên: 08/08/2014, 14:21

... (5¢fi3¢) Corresponding peptide AS1 GGTTGCCTGAGRTGYATHTG a GCLRCIC AS3 GGGCTATTGGTCAGACGCTACACTC GYWSDATL AS3R GAGTGTAGCGTCTGACCAATAGCC GYWSDATL AS4R GATCTGATACGGTCCACACGACAG LSCGPYQI a H ¼ A or C or T; R ¼ AorG;Y¼ ... 12 0A PTH analyser. Synthesis of cDNA Total RNA was extracted using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. It was treated with RNAase...

Ngày tải lên: 19/02/2014, 12:20

... semantics provides a computationally attractive means of representing the semantics of natural language. However, the models used in this formalism are static and are usually infinite. Dynamic ... Dynamic model-theoretic semantics allows the evaluation of a formula to cause the addition of information to the model. This interaction of the evaluation of a formula and...

Ngày tải lên: 21/02/2014, 20:20

... lavelli/satta@irst.it Abstract In this paper a bidirectional parser for Lexicalized Tree Adjoining Grammars will be presented. The algorithm takes advantage of a peculiar characteristic of Lexicalized TAGs, ... BIDIRECTIONAL PARSING OF LEXICALIZED TREE ADJOINING GRAMMARS* Alberto Lavelli and Giorgio Satta Istituto per ia Ricerca Scientifica e Teenologica I - 38050 Povo TN...

Ngày tải lên: 22/02/2014, 10:20

... of Trigonopsis variabilis D-amino acid oxidase and fast comparison of the operational stabilities of free and immobilized preparations of the enzyme. Biotechnol Bioeng 99, 251–260. 36 Nahalka J & Patoprsty ... Garcı ´ a- Fruito ´ s E, Gonzalez-Montalban N, Morell M, Vera A, Ferraz RM, Aris A, Ventura S & Villaverde A (2005) Aggregation as bacterial inclusion bodies does n...

Ngày tải lên: 06/03/2014, 00:20

... Fujita H, Yamanaka M, Imamura K, Tanaka Y, Nara A, Yoshimori T, Yokota S & Himeno M (2003) A dominant negative form of the AAA ATPase SKD1 ⁄ VPS4 impairs membrane trafficking out of endosomal ... D, Uchimura S, Nara A, Yoshimori T, Hayashizaki Y, Kawai J, Ishidoh K et al. (2004) Mammalian class E Vps proteins, SBP1 and mVps2 ⁄ CHMP 2A, interact with and regulate the function of a...

Ngày tải lên: 07/03/2014, 05:20

... implies a shorter angle than the magic angle [38]. If the plane of the disc equals the plane of the particle in the membrane, posit- ive and negative LD values indicate a small and large angle, ... well as a sharp negative feature at 555 nm and pos- itive features near 548 and 530 nm. These data indicate negative LD values for the Q y transitions of chloro- phyll (around 670 and 6...

Ngày tải lên: 07/03/2014, 16:20