Báo cáo khoa học: "Osmotic adjustment in Pinus pinaster cuttings in response to a soil drying cycle" pptx

... fitted to the data, evaluated 796 A. Nguyen-Queyrens et al. A. Nguyen-Queyrens et al.Osmotic adjustment in maritime pine cuttings Note Osmotic adjustment in Pinus pinaster cuttings in response to a ... Plant material and water stress application Cuttings, propagated from five maritime pine seedlings (Pinus pinaster Ait.) were provided by the Forest Genetics and...

Ngày tải lên: 08/08/2014, 14:21

... with Deschampsia, and the remaining 20 boxes were kept without grass. For 3 years, the grass sward and the bare soil were maintained by manual weeding. In 1991, all the boxes ... edn. SAS Institute Inc, Cary, NC, USA Turner NC, Jones MM (1980) Turgor maintenance by osmotic adjustment: a review and evaluation. In: Adaptation of Plants to W...

Ngày tải lên: 08/08/2014, 18:21

... studied. Statistical treatment The data obtained was statistically treated using Multivariant Variance Analysis. In order to increase nor- mality, the germination percentage data was transformed using an ... seed age on germinative response to the effects of fire in Pinus pinaster, Pinus radiata and Eucalyptus globulus Otilia Reyes * and Mercedes Casal Área de Ecolog a, Dpto. d...

Ngày tải lên: 08/08/2014, 14:21

... Pinus pinaster Ait. Stéphanie Mariette a, # , David Chagné a, # , Stéphane Decroocq a , Giuseppe Giovanni Vendramin b , Céline Lalanne a , Delphine Madur a and Christophe Plomion a, * 1 INRA, BP45, ... Amplification of Pinus microsatellites in Pinus pinaster. Species (number of primer pairs tested) Sub-section Amplification d Banding pattern e + – SML SPL C Pinus radia...

Ngày tải lên: 08/08/2014, 14:21

... Statistical Machine Translation using a Maximum Entropy Approach Ismael Garc ´ a Varea Dpto. de Inform´atica Univ. de Castilla-La Mancha Campus Universitario s/n 02071 Albacete, Spain ivarea@info-ab.uclm.es Franz ... outlined in Section 3. 2 Statistical Machine Translation The goal of the translation process in statisti- cal machine translation can be formulated as fol- lows: A sour...

Ngày tải lên: 20/02/2014, 18:20

... CGATTTTCTGGGACTCG Rbbp5 GCATCCATTTCCAGTGGAGT TGGTGACATCCACTTCCTCA Ash2 CCTGAAGCAGACTCCCCATA AGCCCATGTCACTCATAGGG HoxA7 TTCCACTTCAACCGCTACCT TTCATACATCGTCCTCCTCGT Sp1 TCATACCAGGTGCAAACCAA GCTGGGAGTCAAGGTAGCTG MLL1 ... Forward primer (5¢ -to3 ¢ ) Reverse primer (5¢ -to3 ¢) b-actin AGAGCTACGAGCTGCCTGAC GTACTTGCGCTCAGGAGGAG MLL1 GAGGACCCCGGATTAAACAT GGAGCAAGAGGTTCAGCATC Set1 CTGACGAGATGGTCATCGAA...

Ngày tải lên: 23/03/2014, 04:21

... complete tumor area and all detectable mesorectal lymph nodes were paraffin-embedded and investigated using hematoxylin and eosin staining. Pathological Staging/Grading Pathological staging included ... postsurgical and pathological staging results are summarized in Table 3. Pathological Staging Results When comparing pretherapeuthical clinical staging with pathological staging results, RCT...

Ngày tải lên: 09/08/2014, 03:21

... identified an upstream regulator of MAPK cascades, mitogen-activated protein kinase kinase kinase 7 interacting protein 2 (TAK 1 binding protein 2 ¼ TAB 2), as an IEG during hyperosmotic stress in tilapia ... to be addressed. As a result of recent studies on fish aqu- aporins, we know that changes in water permeability in gills and intestine are mediated at least in part via regulat...

Ngày tải lên: 18/02/2014, 16:20

... PDZ domains, a SH3 domain and a catalytically inactive guanylate kinase-like region [4]. Functions of hDlg are related to the establishment and maintenance of cell polarity and the adhesion integrity ... were: N-acetyl- Tyr-Val-Ala-Asp-7-amino-4-metylcoumarin for caspase 1, N-acetyl-Asp-Glu-Val-Asp-7-amino-4-metylcoumarin for caspase 3, N-acetyl-Val-Glu-Ile-Asp-7-amino-4-trifluoro- metyl...

Ngày tải lên: 23/03/2014, 06:20

... the soil drying cycle in P. pinaster. However, in this drought-avoiding Note Leaf gas exchange and carbohydrate concentrations in Pinus pinaster plants subjected to elevated ... échanges gazeux foliaires / glucides / Pinus pinaster 1. INTRODUCTION Maritime pine (Pinus pinaster Ait.) is recognised as a drought-avoiding species with a h...

Ngày tải lên: 08/08/2014, 14:21