Báo cáo khoa học: "Initial mineralization of organic matter in a forest plantation soil following different logging residue management techniques" pps

... (37.6) Original article Initial mineralization of organic matter in a forest plantation soil following different logging residue management techniques Pilar Pérez-Batallón, Guzmán Ouro, Felipe Macías and ... nutrient supply rates are maintained. The main objective of this research was to examine the effect of harvesting and slash management on mineralization...

Ngày tải lên: 08/08/2014, 14:21

... semantics provides a computationally attractive means of representing the semantics of natural language. However, the models used in this formalism are static and are usually infinite. Dynamic ... models are incomplete models that include only the information needed for an application and to which information can be added. Dynamic models are basically approximations of larger...

Ngày tải lên: 21/02/2014, 20:20

...

Ngày tải lên: 07/08/2014, 18:21

...

Ngày tải lên: 07/08/2014, 18:21

... precipitation of a- lactalbumin commenced after 25 min and reached a plateau after 90 min. The amount of DTT-induced aggregation of a- lactalbumin was increased in a concentration-dependent manner ... different target proteins (e.g. whilst Arg-HCl at 250 mm had little effect on the aggregation of insulin or a- synucleinA53T alone, it dramatically increased the aggregation...

Ngày tải lên: 18/02/2014, 16:20

... for critical reading the manuscript and helpful suggestions; and to Dr Valeria Cafaro, Aurora Bracale, Antonella Antignani and Sonia Di Gaetano for preparing some of the RNase variants used in this ... this ability upon dimeri- zation into RNase-AA. The replacement in dimeric RNase-AA of one negat- ively charged residue (Asp38) with an uncharged Gly residue generates an RNase vari...

Ngày tải lên: 19/02/2014, 06:20

... (5¢fi3¢) Corresponding peptide AS1 GGTTGCCTGAGRTGYATHTG a GCLRCIC AS3 GGGCTATTGGTCAGACGCTACACTC GYWSDATL AS3R GAGTGTAGCGTCTGACCAATAGCC GYWSDATL AS4R GATCTGATACGGTCCACACGACAG LSCGPYQI a H ¼ A or C or T; R ¼ AorG;Y¼ ... 12 0A PTH analyser. Synthesis of cDNA Total RNA was extracted using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. It was treated with RNAase...

Ngày tải lên: 19/02/2014, 12:20

... Fushman D, Varadan R, Assfalg A & Walker O (2004) Determining domain orientation in macromolecules by using spin-relaxation and residual dipolar coupling mea- surements. Prog Nuclear Magnetic ... CaMKII and CaMKIV, respectively), CaM kinase kinase (CaMKK), titin kinase, and death associated kinase [4]. Structural studies on CaMKI [5], titin kinase [6] and twitchin kinase [7] have uphe...

Ngày tải lên: 19/02/2014, 17:20

... evidence that N-glycans, in particular their terminal structures, are involved in regulating the GABA translocation of GAT1, but not in binding of GAT1 to GABA. Transport of GABA by GAT1 across the ... chains of GAT1 in uence the affinity of GAT1 for GABA, concentra- tion dependencies were analyzed on the basis of the Michaelis–Menten equation V ¼ V max GABA ½GABA K m GABA...

Ngày tải lên: 19/02/2014, 17:20

... label using instances with that label as positive instances and instances with any other label as negative instanc- es. The final class label is assigned by choosing the class that was assigned ... 2005. Automa- tion of a Problem List Using Natural Language Pro- cessing. BMC Med Inform Decis Mak, 5:30. Guergana K. Savova, James J. Masanz, Philip V. Ogren, Jiaping Zheng, Sunghwan Sohn...

Ngày tải lên: 20/02/2014, 05:20