Báo cáo khoa học: "If a congressist took some time to idle in the countryside near the location of this conference, he/she would encounter" pdf

...

Báo cáo khoa học: How a lipid mediates tumour suppression Delivered on 29 June 2010 at the 35th FEBS Congress in Gothenburg, Sweden pdf

... studies in mammalian cells have also revealedanother important PtdIns3P effector in endosomaltethering and fusion, namely EEA1, a protein thatcontains a Rab5 binding domain and a FYVE domainat ... is that Flamingo, a determinant of planar cell polarity through the nonca-nonical Wnt signalling pathway, accumulates in the cytoplasm instead of translocating to polarized mem-brane domains ... an interactor of UVRAG, as a regulator of autophagy [5]. On the other hand, monoallelic UVRAG mutations associatedwith microsatellite unstable colon cancer have no effecton autophagy, and the...

Báo cáo khoa học: Puroindoline-a and a1-purothionin form ion channels in giant liposomes but exert different toxic actions on murine cells pptx

... understood. There-fore, as a ﬁrst step toward understanding these mecha-nisms, we characterized (a) the pore-forming activity of PIN -a and a1 -PTH in giant liposomes and (b) theirtoxicity to mammalian ... quantiﬁed using the samecells examined before and during the action of the proteins. The 3D projected area of cells was measuredas an index of cell volume. The addition of 10 lm a1 -PTH to the ... as a single peak justafter the PINs. Separate pools of the PTH-containing andPIN-containing crude fractions were dialyzed against de-ionized water and freeze-dried, and a1 -PTH, a2 -PTH andb-PTH...

Báo cáo khoa học: "Applying a Grammar-based Language Model to a Simpliﬁed Broadcast-News Transcription Task" ppt

... words in an utter-ance. More accurate statistical models of naturallanguage have mainly been developed in the ﬁeld of statistical parsing, e.g. Collins (2003), Charniak(2000) and Ratnaparkhi ... linguistically motivated grammar (a hand-crafted Head-driven Phrase StructureGrammar) and a statistical model estimating the probability of a parse tree. The languagemodel is applied by means of an N-best ... accurate,linguistically motivated grammar, and it is undesir-able to weaken the constraints encoded in the gram-mar. Instead, we allow the parser to attach any se-quence of words or correct phrases to the...

Báo cáo khoa học: Utp25p, a nucleolar Saccharomyces cerevisiae protein, interacts with U3 snoRNP subunits and affects processing of the 35S pre-rRNA docx

... indicating that this protein is associated only with the early pre-rRNAs. This is in accordance with the hypothesis of the involvement of Utp25p in the early cleavages of the 35S pre-rRNA, ProtA–Utp25p ... ﬁgureshows autoradiograph of RNA transferred to nylon membrane.Bands corresponding to major intermediates and mature rRNAs areindicated on the right-hand side. A 1 A 0P25’GATC0 16 0 16 h, Glu A *P3GATC016016 ... characterized as a nucleolar protein that interactswith the U3 snoRNP, depletion of which causes inhibi-tion of cleavages at sites A 0 ,A 1and A 2, leading to decreased levels of 18S rRNA...

Báo cáo khoa học: "Using a Randomised Controlled Clinical Trial to Evaluate an NLG System" doc

... than the things you do like. It can be useful to think of it as a balance. Have a look on the scales. What are the good and bad thingsfor you?Add any more that you can think of. Are you ready to ... rest of the STOP team, andespecially to Ian McCann and Annette Hermsefor their work in the clinical trial. Thanks also to Yaji Sripada, Sandra Williams, and the anony-mous reviewers for their ... Smoking Information for Heather StewartYou have good reasons to stop People stop smoking when they really want to stop. It is encouraging thatyou have many good reasons for stopping. The scales...

Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

... Miyazawa K, Tsubouchi H, Naka D, Takahashi K,Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy-ama O, Takahashi K et al. (1989) Molecular cloningand sequence analysis of cDNA for human hepatocytegrowth ... plasma serineproteases, such as HGFA, are activated in response to the activation of the coagulation cascade and in amma-tion. The activated proteases convert pro-HGF to the active form (the ... arestructurally deﬁned by the presence of a short N-termi-nal cytoplasmic domain, a transmembrane domainlocated near the N-terminus, and a C-terminal extra-cellular serine protease domain. In addition,...

Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx

... Takinginto account that the synthetases involved in the bio-synthesis of the DKP-inheriting toxins thaxtominand fumitremorgin also contain a C-terminal conden-sation domain, this C-domain catalyzed ... domain A 4again is predicted to activate l-arginine, displaying60% identity to the characterized A- domain of MycC.Interestingly, A 1and A 4inherit a highly identical(90%) speciﬁcity-determining ... followed by a linear increase to 95% B in 5 min, holding B for anadditional 5 min. This gradient was also used to analyzecomparative extractions of S. erythraea cultures and eryth-rochelin and ferri-erythrochelin.Isolation...

Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

... Biotin-TCGACTAGAAGCTTCTAGAAGCTTCTAGHSE antisense AGCTGATCTTCGAAGATCTTCGAAGATMutated HSEsenseBiotin-TCGACTTCAAGCTTGTACAAGCTTGTAGMutated HSEantisenseAGCTGAAGTTCGAACATGTTCGAACATC‘Scrambled’oligonucleotideBiotin-AACGACGGTCGCTCCGCCTGGCT140406080100120Counts ... procedure The assay was run as a three-step assay: initial incubation of the sample and probe, addition and incubation of the sampleand acceptor beads in the plate wells, and addition of donorbeads ... DNA-binding domain.Stable binding requires simultaneous binding of allDNA-binding domains in a trimer to three adjacentnGAAn repeats. Therefore, a functional HSE containsat least three nGAAn...

Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt

... impingeon the translational machinery in TNFa-treated orTRAIL-treated cells. In particular, we have observedincreased association of the inhibitory protein eukary-otic initiation factor 4E-binding ... cascade of activation of effector casp-ases that ultimately leads to the multiple changes in cells characteristic of TRAIL-induced apoptosis [27]. The process of activation of caspase-8, and the ... incorporation of [35S]methionine into total protein in cells that had orhad not been pretreated with IFNa. The data shown in Fig. 1A indicate that the combination of the twocytokines had a marked...

Xem thêm