Báo cáo khoa học: "If a congressist took some time to idle in the countryside near the location of this conference, he/she would encounter" pdf

Ngày tải lên: 08/08/2014, 14:20

... studies in mammalian cells have also revealed another important PtdIns3P effector in endosomal tethering and fusion, namely EEA1, a protein that contains a Rab5 binding domain and a FYVE domain at ... is that Flamingo, a determinant of planar cell polarity through the nonca- nonical Wnt signalling pathway, accumulates in the cytoplasm instead of translocating to polari...

Ngày tải lên: 06/03/2014, 01:23

... understood. There- fore, as a first step toward understanding these mecha- nisms, we characterized (a) the pore-forming activity of PIN -a and a1 -PTH in giant liposomes and (b) their toxicity to mammalian ... quantified using the same cells examined before and during the action of the proteins. The 3D projected area of cells was measured as an index of cell volume. T...

Ngày tải lên: 07/03/2014, 12:20

... words in an utter- ance. More accurate statistical models of natural language have mainly been developed in the field of statistical parsing, e.g. Collins (2003), Charniak (2000) and Ratnaparkhi ... linguistically motivated grammar (a hand-crafted Head-driven Phrase Structure Grammar) and a statistical model estimating the probability of a parse tree. The language model i...

Ngày tải lên: 17/03/2014, 02:20

... indicating that this protein is associated only with the early pre- rRNAs. This is in accordance with the hypothesis of the involvement of Utp25p in the early cleavages of the 35S pre-rRNA, ProtA–Utp25p ... figure shows autoradiograph of RNA transferred to nylon membrane. Bands corresponding to major intermediates and mature rRNAs are indicated on the right-hand...

Ngày tải lên: 22/03/2014, 21:21

... than the things you do like. It can be useful to think of it as a balance. Have a look on the scales. What are the good and bad things for you? Add any more that you can think of. Are you ready to ... rest of the STOP team, and especially to Ian McCann and Annette Hermse for their work in the clinical trial. Thanks also to Yaji Sripada, Sandra Williams, and the...

Ngày tải lên: 23/03/2014, 19:20

... Miyazawa K, Tsubouchi H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy- ama O, Takahashi K et al. (1989) Molecular cloning and sequence analysis of cDNA for human hepatocyte growth ... plasma serine proteases, such as HGFA, are activated in response to the activation of the coagulation cascade and in amma- tion. The activated proteases convert pro-HGF...

Ngày tải lên: 15/02/2014, 01:20

... Taking into account that the synthetases involved in the bio- synthesis of the DKP-inheriting toxins thaxtomin and fumitremorgin also contain a C-terminal conden- sation domain, this C-domain catalyzed ... domain A 4 again is predicted to activate l-arginine, displaying 60% identity to the characterized A- domain of MycC. Interestingly, A 1 and A 4 inherit a hig...

Ngày tải lên: 16/02/2014, 09:20

... Biotin-TCGACTA GAAGCTTCTAGAAGCTTCTAG HSE antisense AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide Biotin-AACGACGGTCGCTCCGCCTGGCT 140 40 60 80 100 120 Counts ... procedure The assay was run as a three-step assay: initial incubation of the sample and probe, addition and inc...

Ngày tải lên: 18/02/2014, 14:20

... impinge on the translational machinery in TNFa-treated or TRAIL-treated cells. In particular, we have observed increased association of the inhibitory protein eukary- otic initiation factor 4E-binding ... cascade of activation of effector casp- ases that ultimately leads to the multiple changes in cells characteristic of TRAIL-induced apoptosis [27]. The process of a...

Ngày tải lên: 19/02/2014, 06:20