Báo cáo khoa học: "Structural and functional characterization of the 5’ upstream region of a glutamine synthetase gene from Scots pine" pdf

Báo cáo khoa học: Structural and functional characterization of human Iba proteins ppt

... core of Iba2 is a pair of EF-hand motifs, denoted as EF-hands 1 and 2,each consisting of two a helices (aA, aB and aC, aD,respectively) ﬂanking a loop region able to bind calciumions in EF-hand ... 855–862.2 Kawasaki H, Nakayama S & Kretsinger RH (1998)Classiﬁcation and evolution of EF-hand proteins. Bio-metals 11, 277–295.3 Ohsawa K, Imai Y, Kanazawa H, Sasaki Y & KohsakaS (2000) ... truncation mutant of neurabin-2 (E).Fig. 6. Calcium-binding assay for Iba1 and Iba2. Iba1, Iba2 and calmodulin where dialyzed against 100 lM CaCl2 and a traceamount of 45CaCl2. Upon dialysis,...

Báo cáo khoa học: "Structural and functional characterization of the 5’ upstream region of a glutamine synthetase gene from Scots pine" pdf

... et al .Scots pine GS 1a promoterOriginal articleStructural and functional characterization of the 5’ upstream region of a glutamine synthetase gene from Scots pineConcepción Avila a , Francisco ... the gene. There is a canonical TATA box at–35 bp from the transcription start site and a putative CAATbox at –138 bp. The 5’ region also contains two A/ T-rich se-quences starting at –720 and ... R. Cantón a , Pilar Barnestein a ,Mar a- Fernanda Suárez a , Pierre Marraccini a* *, Manuel Reyb, Jaime M. Humarac,Ricardo Ordásc and Francisco M. Cánovas a* a Departamento de Biolog a Molecular...

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... methylation of GPR150, ITGA8 and HOXD11 in ovarian cancers. Life Sci 80, 1458–1465.9 Suzuki E, Imoto I, Pimkhaokham A, Nakagawa T,Kamata N, Kozaki KI, Amagasa T & Inazawa J (2007)PRTFDC1, a ... Canyuk B, Focia PJ & Eakin AE (2001) The role foran invariant aspartic acid in hypoxanthine phospho-ribosyltransferases is examined using saturation muta-genesis, functional analysis, and ... residues from the C-terminus and consists of a two-stranded anti-parallel b-sheet composed of b2 and b9 and an a- helix from the C-terminus (Fig. 1A) . The two subunits in the asymmetric unit, together...

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... templateusing Deep Vent DNA polymerase (New England Biolabs,Ipswich, MA, USA), a sense primer (CATATGGCTAGCATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCGTGCCAACTCCCAC) ... Billerica, MA, USA).Initial characterization of the protein The purity and molecular mass of the protein were checkedby 12% SDS ⁄ PAGE and MALDI-TOF MS. Gel-permeationchromatography with 200 lLofa1mgÆmL)1protein ... S, Khachatr-yan A, Vyas S, Arrowsmith CH, Clarke S, Edwards A, Joachimiak A et al. (2001) Structure of Thermotogamaritima stationary phase survival protein SurE: a novel acid phosphatase. Structure...

Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

... (5¢-GATTTTTGTGGCTGGAACAGGAAACCCATATTTTACAACTGATTCG) and F133N-rv (5¢-CGAATCAGTTGTAAAATATGGGTTTCCTGTTCCAGCCACAAAAAT), with the alterednucleotides shown in bold and underlined. The F13 3A mutation ... Essential genes of a minimal bacte-rium. Proc Natl Acad Sci USA 103, 425–430.12 Yamanaka K, Ogura T, Niki H & Hiraga S (1992)Identiﬁcation and characterization of the smbA gene, a suppressor ... was created using the following primers: F13 3A- fw (5¢-GTGGCTGGAACAGGAGCGCCATATTTTACAACTGATTCG) and F13 3A- rv (5¢-CGAATCAGTTGTAAAATATGGCGCTCCTGTTCCAGCCAC). The mutationswere veriﬁed by DNA...

Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

... sites using a forwardoligomer 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCGCAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCTCGAATTCG GATCCGGTACCTCAGAAGGTAGACAGCAGAACC-3¢. For derivitization with TMR, a Gly-Gly-Cyssequence ... throughout the polypeptide chain and hides a large amount of the hydrophobic surface area. Surfacearea calculations for the pentamer give a total surfacearea of  81 000 A ˚2with 30% ( 24 000 A ˚2) ... A ˚2) as con-tact area. Thus, a large amount of the available surfacearea of the molecule is buried upon pentamerization,increasing the stability of the protein. The hAd2 ⁄ 12 penton base monomer...

Tài liệu Báo cáo khoa học: Structural and functional speciﬁcities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family docx

... removal of the CUBdomains and thereby activation of the growth factordomains. PDGF-C and -D contain both the CUB and growth factor domains when they are secreted and pro-teolytic cleavage is therefore ... domain and the ﬁnal 30residues in the C-terminal end of the growth factordomain. These splice variants are also present inhuman thyroid papillary carcinomas (L. J. Reigstad,J. E. Varhaug and ... cleavagesites (black arrows) are denoted. Exons and introns are not drawn in scale. The PDGF -A and -B genes cover approximately 20 kb and the PDGF-C and -D cover approximately200 kb. Alternative...

Tài liệu Báo cáo khoa học: Molecular and functional characterization of adenylate kinase 2 gene from Leishmania donovani pdf

... the cloning and functional characterization of an AK gene from a genomic library of L. donovani as well as its expression and molecular characterization. Materials and methodsMaterialsPlasmids pGEM-3Zf(+) ... with Ap5 A, an inhibitor of leishmanial AK2 and itspartial reversal by ADP indicate the importance of thisenzyme in leishmania growth and proliferation. The effect of Ap5 A on other metabolic ... expression The AK gene was ampliﬁed by PCR from L. donovanigenomic DNA. The sense primer 5¢-ACATGCATGCATGAAGATCGTGATGGAAGG-3¢ introduces an SphIrestriction site and the antisense one 5¢-AACTGCAGGCTTTCACCAGAATTTCCACC-3¢...

Báo cáo khoa học: Structural and functional aspects of unique type IV secretory components in the Helicobacter pylori cag-pathogenicity island potx

... expressionlevels of cagC and cagf reached values analogous togenes important for bacterial survival and homeostasis,such as catalase, urease and NapA; by contrast, the transcript abundance of other cag genes ... available, along with Caga ATPase. The lack of a clear picture of the biological func-tion and organization of some cagPAI components isalso a major obstacle to structural studies becausemost of these ... includ-ing CagX, CagY, CagT, CagV and Cagd, as well asother Cag components such as the ATPase CagE,CagF, CagG, CagZ and CagS [16]. In a different studyemploying a similar approach, interactions...

Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf

... 5¢-CACGTACAAAGAGAACGTCGACGACG-3¢5¢-CGTCGTCGACGTTCTCTTTGTACGTG-3¢R11 4A 5¢-GAGAATTTCGAGCACGATACAGACTCCC-3¢5¢-GGGAGTCTGTATCGTGCTCGAAATTCTC-3¢Y116D 5¢-CGACGACGAGACAGACTCCCAGAACATGTC-3¢5¢-GACATGTTCTGGGAGTCTGTCTCGTCGTCG-3¢Y. Sun et al. ... assense and antisense, respectively, for each mutation.p26mutation PrimerR110G 5¢-GGACACGTACAAGGAGAATTTCGACGACG-3¢5¢-CGTCGTCGAAATTCTCCTTGTACGTGTCC-3¢F112R 5¢-CACGTACAAAGAGAACGTCGACGACG-3¢5¢-CGTCGTCGACGTTCTCTTTGTACGTG-3¢R11 4A ... by a Natural Sciences and Engineering Research Council of Canada DiscoveryGrant, a Nova Scotia Health Research Founda-tion ⁄ Canadian Institutes of Health Research RegionalPartnership Plan...

Xem thêm