Báo cáo khoa học: "Structural and functional characterization of the 5’ upstream region of a glutamine synthetase gene from Scots pine" pdf

Báo cáo khoa học: Structural and functional characterization of human Iba proteins ppt

Báo cáo khoa học: Structural and functional characterization of human Iba proteins ppt

... core of Iba2 is a pair of EF-hand motifs, denoted as EF-hands 1 and 2, each consisting of two a helices (aA, aB and aC, aD, respectively) flanking a loop region able to bind calcium ions in EF-hand ... 855–862. 2 Kawasaki H, Nakayama S & Kretsinger RH (1998) Classification and evolution of EF-hand proteins. Bio- metals 11, 277–295. 3 Ohsawa K, Imai Y, Kanazawa H, Sasak...

Ngày tải lên: 16/03/2014, 06:20

14 546 0
Báo cáo khoa học: "Structural and functional characterization of the 5’ upstream region of a glutamine synthetase gene from Scots pine" pdf

Báo cáo khoa học: "Structural and functional characterization of the 5’ upstream region of a glutamine synthetase gene from Scots pine" pdf

... et al .Scots pine GS 1a promoter Original article Structural and functional characterization of the 5’ upstream region of a glutamine synthetase gene from Scots pine Concepción Avila a , Francisco ... the gene. There is a canonical TATA box at –35 bp from the transcription start site and a putative CAAT box at –138 bp. The 5’ region also co...

Ngày tải lên: 08/08/2014, 14:20

6 328 0
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... methylation of GPR150, ITGA8 and HOXD11 in ovarian cancers. Life Sci 80, 1458–1465. 9 Suzuki E, Imoto I, Pimkhaokham A, Nakagawa T, Kamata N, Kozaki KI, Amagasa T & Inazawa J (2007) PRTFDC1, a ... Canyuk B, Focia PJ & Eakin AE (2001) The role for an invariant aspartic acid in hypoxanthine phospho- ribosyltransferases is examined using saturation muta- genesis, functional an...

Ngày tải lên: 15/02/2014, 01:20

11 770 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG TGCCAACTCCCAC) ... Billerica, MA, USA). Initial characterization of the protein The purity and molecular mass of the protein were checked by 12% SDS ⁄ PAGE and MALDI-TOF MS...

Ngày tải lên: 18/02/2014, 14:20

10 554 0
Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

... (5¢-GATTTTTGTGGCT GGAACAGGA AACCCATATTTTACAACTGATTCG) and F133N-rv (5¢-CGAATCAGTTGTAAAATATGG GT TTCCTGTTCCAGCCACAAAAAT), with the altered nucleotides shown in bold and underlined. The F13 3A mutation ... Essential genes of a minimal bacte- rium. Proc Natl Acad Sci USA 103, 425–430. 12 Yamanaka K, Ogura T, Niki H & Hiraga S (1992) Identification and characterization of t...

Ngày tải lên: 18/02/2014, 16:20

12 657 0
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

... sites using a forward oligomer 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢. For derivitization with TMR, a Gly-Gly-Cys sequence ... throughout the polypeptide chain and hides a large amount of the hydrophobic surface area. Surface area calculations for the pentamer give a total surface ar...

Ngày tải lên: 19/02/2014, 06:20

10 648 0
Tài liệu Báo cáo khoa học: Structural and functional specificities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family docx

Tài liệu Báo cáo khoa học: Structural and functional specificities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family docx

... removal of the CUB domains and thereby activation of the growth factor domains. PDGF-C and -D contain both the CUB and growth factor domains when they are secreted and pro- teolytic cleavage is therefore ... domain and the final 30 residues in the C-terminal end of the growth factor domain. These splice variants are also present in human thyroid papillary carcinomas...

Ngày tải lên: 19/02/2014, 07:20

19 558 0
Tài liệu Báo cáo khoa học: Molecular and functional characterization of adenylate kinase 2 gene from Leishmania donovani pdf

Tài liệu Báo cáo khoa học: Molecular and functional characterization of adenylate kinase 2 gene from Leishmania donovani pdf

... the cloning and functional characterization of an AK gene from a genomic library of L. donovani as well as its expression and molecular characterization. Materials and methods Materials Plasmids pGEM-3Zf(+) ... with Ap 5 A, an inhibitor of leishmanial AK2 and its partial reversal by ADP indicate the importance of this enzyme in leishmania growth and prolifer...

Ngày tải lên: 21/02/2014, 00:20

9 487 0
Báo cáo khoa học: Structural and functional aspects of unique type IV secretory components in the Helicobacter pylori cag-pathogenicity island potx

Báo cáo khoa học: Structural and functional aspects of unique type IV secretory components in the Helicobacter pylori cag-pathogenicity island potx

... expression levels of cagC and cagf reached values analogous to genes important for bacterial survival and homeostasis, such as catalase, urease and NapA; by contrast, the transcript abundance of other cag genes ... available, along with Caga ATPase. The lack of a clear picture of the biological func- tion and organization of some cagPAI components is also a major o...

Ngày tải lên: 06/03/2014, 00:21

9 496 0
Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf

Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf

... 5¢-CACGTACAAAGAGAACGTCGACGACG-3¢ 5¢-CGTCGTCGACGTTCTCTTTGTACGTG-3¢ R11 4A 5¢-GAGAATTTCGAGCACGATACAGACTCCC-3¢ 5¢-GGGAGTCTGTATCGTGCTCGAAATTCTC-3¢ Y116D 5¢-CGACGACGAGACAGACTCCCAGAACATGTC-3¢ 5¢-GACATGTTCTGGGAGTCTGTCTCGTCGTCG-3¢ Y. Sun et al. ... as sense and antisense, respectively, for each mutation. p26 mutation Primer R110G 5¢-GGACACGTACAAGGAGAATTTCGACGACG-3¢ 5¢-CGTCGTCGAAATTCTCCTTGTACGTGTCC...

Ngày tải lên: 07/03/2014, 12:20

15 516 0
Từ khóa:
w