... article as: Tsuruta et al.: Therapeutic ultrasound as a potential male contraceptive: power, frequency and temperature required to deplete rat testes of meiotic cells and epididymides of sperm determined ... RESEARCH Open Access Therapeutic ultrasound as a potential male contraceptive: power, frequency and temperature req...
Ngày tải lên: 05/03/2014, 17:20
... GAT CATGCACTGAAATTTA (2), GATGAAACCTCTCAA ACTG (3), and CATCATCGCTGGACAATGT (4)], using T. R. Dunkern and A. Hatzelmann Characterization of inhibitors of PDE1C FEBS Journal 274 (2007) 48124824 ê 2007 The Authors ... & Prop G (1986) Inhibition of human platelet aggregation by motapizone via an increase in intracellular cAMP. Agents Actions Suppl 20, 249–257. 29 Thompson WJ &am...
Ngày tải lên: 07/03/2014, 05:20
Final Report on Assessment Instruments for a Prospective Payment System potx
... class="bi x0 y1 w2 he" alt=""
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: "Enhancing a large scale dictionary with a two-level system" potx
Ngày tải lên: 09/03/2014, 01:20
Báo cáo khoa học: "HAHAcronym: A Computational Humor System" potx
... 113–116, Ann Arbor, June 2005. c 2005 Association for Computational Linguistics HAHAcronym: A Computational Humor System Oliviero Stock and Carlo Strapparava ITC-irst, Istituto per la Ricerca Scientifica ... of the cases. A curiosity that may be worth mentioning: HA- HAcronym participated to a contest about (human) production of best acronyms, organized by RAI, the Italian Nationa...
Ngày tải lên: 17/03/2014, 06:20
Báo cáo khoa học: Identification of sodium salicylate as an hsp inducer using a simple screening system for stress response modulators in mammalian cells pptx
... sodium salicylate as an hsp inducer using a simple screening system for stress response modulators in mammalian cells Keiichi Ishihara, Kenji Horiguchi, Nobuyuki Yamagishi and Takumi Hatayama Department ... examined the effects of SA on stress response in mammalian cells using a simple screening system, and revealed that SA is a poten...
Ngày tải lên: 17/03/2014, 10:20
From the Critics’ Corner: Logic Blending, Discursive Change and Authenticity in a Cultural Production System* potx
... accountability. As a result, marketing techniques and managerial- ism associated with the commercial market logic have crept into the arts, thereby threatening the purity and longstanding dominance of the aesthetic ... Publishing Ltd 2005 From the Critics’ Corner: Logic Blending, Discursive Change and Authenticity in a Cultural Production System*...
Ngày tải lên: 30/03/2014, 16:20
Báo cáo khoa học: "Linear Text Segmentation using a Dynamic Programming Algorithm" potx
... Linear Text Segmentation using a Dynamic Programming Algorithm Athanasios Kehagias Dept. of Math., Phys. and Comp. Sciences Aristotle Univ of Thessaloniki GREECE kehagias@egnatia.ee.auth.gr Fragkou ... (Heinonen, 1998) and Utiyama and Isahara (Utiyama and Isa- hara, 2001). Finally, other researchers use probabilistic ap- proaches to text segmentation including the use of hidd...
Ngày tải lên: 31/03/2014, 20:20
Báo cáo hóa học: " Results of Clinicians Using a Therapeutic Robotic System in an Inpatient Stroke Rehabilitation Unit" potx
... robotic system at baseline and at dis- charge. An occupational therapist blinded to patient allocation administered the CAHAI-7 and the CMSA at admission and discharge. At discharge, participants completed ... 8:50 http://www.jneuroengrehab.com/content/8/1/50 Page 11 of 12 RESEARCH Open Access Results of Clinicians Using a Therapeutic Robotic System in an Inpatie...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học: " Strain-dependent variation in the early transcriptional response to CNS injury using a cortical explant system" doc
... Forward CCTTCCAGGATGAGGACATGA 71 bp NM_008361.3 interleukin 1 beta Reverse TGAGTCACAGAGGATGGGCTC IL-6 Forward GAGGATACCACTCCCAACAGACC 141 bp NM_031168.1 interleukin 6 Reverse AAGTGCATCATCGTTGTTCATACA IL-12 ... TGTACAGAGCTCCACGGCTG CiiTA Forward GCATGTTGCACACCAGCTCCCT 135 bp NM_007575.2 major histocompatibility complex class II transactivator Reverse ACGCCAGTCTGACGAAGGTCCA COX-2 Forward CAGACA...
Ngày tải lên: 19/06/2014, 22:20
Vertical Shaft Plumbness Using a Laser Alignment System potx
... Mirror Assembly Plumbness is measured by simply attaching the system to the vertical shaft by means of its integrated magnetic feet and rotating the shaft to four positions 90 degrees apart as ... these two approaches. Figure 6 Attaching the PERMAPLUMB đ to the Hydro Shaft Using PERMAPLUMB for Vertical Hydro Shaft Alignment The PERMAPLUMB system can re...
Ngày tải lên: 08/08/2014, 13:20
Báo cáo sinh học: "Evaluating antibiotics for use in medicine using a poloxamer biofilm model" potx
... Microbiology and Antimicrobials Open Access Research Evaluating antibiotics for use in medicine using a poloxamer biofilm model Abi L Clutterbuck 1,3 , Christine A Cochrane 2,3 , Jayne Dolman 3 and ... the use of poloxamer as a sub- stitute for antimicrobial susceptibility testing and hypoth- esized that bacteria would grow in a biofilm state in poloxam...
Ngày tải lên: 08/08/2014, 19:20
Báo cáo khoa học: " Predicting mortality in intensive care unit survivors using a subjective scoring system" pdf
... Kruse JA, Thill-Baharozian MC, Carlson RW: Comparison of clin- ical assessment with APACHE II for predicting mortality risk in patients admitted to a medical intensive care unit. JAMA 1988, 260:1739-1742. 10. ... 31:1345-1355. 7. Zimmerman JE, Kramer AA, McNair DS, Malila FM: Acute Physi- ology and Chronic Health Evaluation (APACHE) IV: hospital mortality assessment for today’s...
Ngày tải lên: 13/08/2014, 03:20
Báo cáo y học: "Fast and systematic genome-wide discovery of conserved regulatory elements using a non-alignment based approach" ppsx
... Ste12p STE2 Rox1p Ste12p RRPE CER cgtgcattaagacaggctagtaTAAACGAGAAGAAGtatcctgctttgcaaTGAAACAATAGtatccgctaagaatttaagcaggccaac PAR cctg-agtaagacagcctagtacAAATGAAAAgAACCACActgctttacaataaaacaacggtacccactaagaattcaggcaggctgtc * ... TGAAACAATAGtatc-cgctaagaatttaagcaggcc BAY tccacgcatggggattgctTGAAGAAaataggaagaaccg-gctgc TTCAACATGAAACAtcagtactatactgtcaactcctgtaggct PAR ctcctg-agtaagacagcctagtacAAATGA...
Ngày tải lên: 14/08/2014, 14:21