Báo cáo toán học: "A new determinant expression of the zeta function for a hypergraph" ppt
Báo cáo toán học: "A new determinant expression of the zeta function for a hypergraph" ppt
... of the usu al Laplacian of a graph . We present a new
determinant expression for th e Ihara-Selberg zeta function of a hyp ergraph, and
give a linear algebraic proof of Storm’s Theorem. Furthermore, ... defined
zeta functions of graphs, and showed that the reciprocals of zeta functions of regular
graphs are explicit polynomials. A zeta function...
Báo cáo toán học: "Differential display identifies overexpression of the USP36 gene, encoding a deubiquitinating enzyme, in ovarian cancer" pot
...
ggatccatttaggtgacactatagaagtacctgaaaggaagcttttttttttcg
aggatttcctgtatttattaagttacaagttggcaggcacagcttgagcaacat
agaaaagtaatcttcttgagttatacaatcatttaaattccaaagcactcacaa
aattgagcaaacaaagccactatttgcatatttgggaaaggaaacatattgct
aacgtaagcttcctgaatccttcatggcctatagtgagtcgtattagaattc-3’
). The synthesized ...
column, and its specific activity was measured by
liquid scintillation analysis. The probe...
Báo cáo khoa học: "Primary undifferentiated embryonal sarcoma of the liver mistaken for hydatid disease" pptx
... a case of a primary hepatic undifferentiated embryonal sarcoma arising in a 21-year-old
male mistaken for hydatid disease of the liver. The rapid recurrence of this tumor along the site of attempted ... Achraf Shamseddine
1
, Mohamed Khalife
1
Abstract
Primary undifferentiated embryonal sarcoma of the liver is a rare tumor with a peak incidence between the ages...
Báo cáo toán học: " Metabolite proving fungal cleavage of the aromatic core part of a fluoroquinolone antibiotic" pdf
... provided all interpretations of the chemical raw data. All authors read and
approved the final manuscript.
Acknowledgements
Part of this work was presented at the 111th Annual General Meeting of the ... biodegradation of the
aromatic core part of a FQ has not yet been reported. Our aim was to characterize the basic
degradation scheme for PRA in G. striatum and t...
Báo cáo toán học: "Iodine Alters Gene Expression in the MCF7 Breast Cancer Cell Line: Evidence for an Anti-Estrogen Effect of Iodine" doc
... 2.0) on a glass slide. RNA amplifica-
tion and labeling was performed using the Mes-
sageAmp™ aRNA Amplification Kit (Ambion, Austin,
TX). Equal micrograms of fragmented, labeled aRNA
was hybridized ... treatment, total RNA was iso-
lated using RNAeasy mini kits (Qiagen, Valencia, CA)
according to the manufacturer. RNA was quantified
using a Bio-Mini DNA/RNA/Protein Analyzer (Sh...
Báo cáo khoa học: Identification and expression of the first nonmammalian amyloid-b precursor-like protein APLP2 in the amphibian Xenopus laevis ppt
... such as the absence of the
exon encoding the KPI domain and the lack of a second
heparin-binding domain [3,4,13,26].
Comparative analysis of the
Xenopus
and mammalian
APLP2 proteins
Comparing the ... 5¢-RACE was
performed using adaptor primer 5¢-CCATCCTAATAC
GACTCACTATAGGGC-3¢ and gene specific reverse
primer 5¢-CAGCAAGTACGTGGTGGTAATGACGG-3¢
(obtained from an EST database s...
Báo cáo toán học: "An On-Line Version of the Encyclopedia of Integer Sequences" doc
... are planning to make the new version available also as a book [2] and as part of a Maple
package (probably prepared by Simon Plouffe and myself in collaboration with Bruno Salvy).
Each of the three ... in a message. The program will automatically inform you
of the first seven sequences in the collection that match each line.
2. Background
The new version was produced...
Báo cáo toán học: "Efficient covering designs of the complete graph" pptx
... the probability that two fixed edges (a
i
,a
j
)and (a
k
,a
l
) are D
π
-bad. Consider first the
case where (a
i
,a
j
)and (a
k
,a
l
) share an endpoint, say a
k
= a
i
.Sinceπis random, the probability
that ... probability
that (a
i
,a
j
)and (a
i
,a
l
) appear in the same member of D
π
is exactly
h−2
r−2
.Toseethis,fixπ (a
i
)
and π (a
j
), and let Q denote th...
Báo cáo toán học: "An alternative definition of the notion valuation in the theory of near polygons" pot
... the diameter
of Γ, then the near polygon is called a near 2d-gon. A near 0-gon is a point and a near
2-gon is a line. Near quadrangles are usually called generalized quadrangles (Payne and
Thas ... following: (I) all local spaces of a thick dual polar space of rank n ≥ 2 are regular;
(II) all local spaces of the near 2n-gon I
n
, n ≥ 2, are regular; (III) all local s...
Báo cáo toán học: "Preliminary measurement and simulation of the spatial distribution of the Morphogenetically Active Radiation (MAR) within an isolated tree canopy" docx
... 0.03 and 0.16 around a mean value
of 0.07. The variability of leaf transmittance was more
marked at the top and the bottom than in the middle part
of the tree. Both PAR transmittance and reflectance
tended ... of the tree. A
vertical gradient of the mean transmittance existed from
the bottom to the top of the tree crown. Like in the PAR
domain, the vari...
Từ khóa: