Báo cáo toán học: "A new determinant expression of the zeta function for a hypergraph" ppt

... of the usu al Laplacian of a graph . We present a new determinant expression for th e Ihara-Selberg zeta function of a hyp ergraph, and give a linear algebraic proof of Storm’s Theorem. Furthermore, ... defined zeta functions of graphs, and showed that the reciprocals of zeta functions of regular graphs are explicit polynomials. A zeta function...

Ngày tải lên: 08/08/2014, 01:20

... ggatccatttaggtgacactatagaagtacctgaaaggaagcttttttttttcg aggatttcctgtatttattaagttacaagttggcaggcacagcttgagcaacat agaaaagtaatcttcttgagttatacaatcatttaaattccaaagcactcacaa aattgagcaaacaaagccactatttgcatatttgggaaaggaaacatattgct aacgtaagcttcctgaatccttcatggcctatagtgagtcgtattagaattc-3’ ). The synthesized ... column, and its specific activity was measured by liquid scintillation analysis. The probe...

Ngày tải lên: 08/08/2014, 17:20

... a case of a primary hepatic undifferentiated embryonal sarcoma arising in a 21-year-old male mistaken for hydatid disease of the liver. The rapid recurrence of this tumor along the site of attempted ... Achraf Shamseddine 1 , Mohamed Khalife 1 Abstract Primary undifferentiated embryonal sarcoma of the liver is a rare tumor with a peak incidence between the ages...

Ngày tải lên: 09/08/2014, 03:21

... provided all interpretations of the chemical raw data. All authors read and approved the final manuscript. Acknowledgements Part of this work was presented at the 111th Annual General Meeting of the ... biodegradation of the aromatic core part of a FQ has not yet been reported. Our aim was to characterize the basic degradation scheme for PRA in G. striatum and t...

Ngày tải lên: 20/06/2014, 21:20

... 2.0) on a glass slide. RNA amplifica- tion and labeling was performed using the Mes- sageAmp™ aRNA Amplification Kit (Ambion, Austin, TX). Equal micrograms of fragmented, labeled aRNA was hybridized ... treatment, total RNA was iso- lated using RNAeasy mini kits (Qiagen, Valencia, CA) according to the manufacturer. RNA was quantified using a Bio-Mini DNA/RNA/Protein Analyzer (Sh...

Ngày tải lên: 08/08/2014, 17:20

... such as the absence of the exon encoding the KPI domain and the lack of a second heparin-binding domain [3,4,13,26]. Comparative analysis of the Xenopus and mammalian APLP2 proteins Comparing the ... 5¢-RACE was performed using adaptor primer 5¢-CCATCCTAATAC GACTCACTATAGGGC-3¢ and gene specific reverse primer 5¢-CAGCAAGTACGTGGTGGTAATGACGG-3¢ (obtained from an EST database s...

Ngày tải lên: 16/03/2014, 16:20

... are planning to make the new version available also as a book [2] and as part of a Maple package (probably prepared by Simon Plouffe and myself in collaboration with Bruno Salvy). Each of the three ... in a message. The program will automatically inform you of the first seven sequences in the collection that match each line. 2. Background The new version was produced...

Ngày tải lên: 07/08/2014, 06:20

... the probability that two fixed edges (a i ,a j )and (a k ,a l ) are D π -bad. Consider first the case where (a i ,a j )and (a k ,a l ) share an endpoint, say a k = a i .Sinceπis random, the probability that ... probability that (a i ,a j )and (a i ,a l ) appear in the same member of D π is exactly h−2 r−2 .Toseethis,fixπ (a i ) and π (a j ), and let Q denote th...

Ngày tải lên: 07/08/2014, 06:20

... the diameter of Γ, then the near polygon is called a near 2d-gon. A near 0-gon is a point and a near 2-gon is a line. Near quadrangles are usually called generalized quadrangles (Payne and Thas ... following: (I) all local spaces of a thick dual polar space of rank n ≥ 2 are regular; (II) all local spaces of the near 2n-gon I n , n ≥ 2, are regular; (III) all local s...

Ngày tải lên: 07/08/2014, 21:21

... 0.03 and 0.16 around a mean value of 0.07. The variability of leaf transmittance was more marked at the top and the bottom than in the middle part of the tree. Both PAR transmittance and reflectance tended ... of the tree. A vertical gradient of the mean transmittance existed from the bottom to the top of the tree crown. Like in the PAR domain, the vari...

Ngày tải lên: 08/08/2014, 14:22