Báo cáo khoa học: "Modification of pharmacokinetics of norfloxacin following oral administration of curcumin in rabbits" pps

Báo cáo khoa học: "Medical treatment for the terminally ill: the ‘risk of unacceptable badness’"

Báo cáo khoa học: "Medical treatment for the terminally ill: the ‘risk of unacceptable badness’"

... end -of- life issues to patients and their families [11]. It is not uncommon for physicians to ask loaded questions in their quest for end -of- life decisions. For example, ‘This is your grandmother’s ... futile. Under the current rules, the only test of futility is that embodied by the question, ‘Will this treatment result in sustained life?’ If the answer is ‘yes’, then vi...
Ngày tải lên : 25/10/2012, 10:45
  • 2
  • 463
  • 0
Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt

Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt

... antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid Bilal A. Azakir, Guillaume Desrochers and Annie Angers De ´ partement ... tBid levels and the ubiquitin ligase activity of Itch. In this study, we first examined the ability of Itch to interact w...
Ngày tải lên : 16/02/2014, 09:20
  • 12
  • 718
  • 0
Tài liệu Báo cáo khoa học: Toggle switches, pulses and oscillations are intrinsic properties of the Src activation/deactivation cycle doc

Tài liệu Báo cáo khoa học: Toggle switches, pulses and oscillations are intrinsic properties of the Src activation/deactivation cycle doc

... Toggle switches, pulses and oscillations are intrinsic properties of the Src activation/deactivation cycle Nikolai P. Kaimachnikov 1,2 and Boris N. Kholodenko 1,3 1 Department of Pathology, ... branch of the Z-shaped curve (i.e. low Src activity) and the state O 3 at the upper branch (i.e. high Src activity) are both Switches, pulses and os...
Ngày tải lên : 18/02/2014, 11:20
  • 17
  • 512
  • 0
Tài liệu Báo cáo khoa học: Competition between innate multidrug resistance and intracellular binding of rhodamine dyes pdf

Tài liệu Báo cáo khoa học: Competition between innate multidrug resistance and intracellular binding of rhodamine dyes pdf

... 2008 FEBS Competition between innate multidrug resistance and intracellular binding of rhodamine dyes Daniella Yeheskely-Hayon, Ronit Regev, Hagar Katzir and Gera D. Eytan Department of Biology, ... active pumping of the agents out of the cells and their pas- sive uptake [10,31] and (b) competition between the active pumping of the agents out of the...
Ngày tải lên : 18/02/2014, 13:20
  • 12
  • 651
  • 0
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

... GGGTTCT AACAAG GGTGCT-3Â;Abc, 5Â-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3Â;Ab- start, 5Â-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3Â;Abstop, 5Â-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3Â. The ... according to the manufacturer’s guidelines and using the following primers: Aba, 5Â-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3Â;Abb, 5Â-GTTCACCACCAGAAGCT GGTGT...
Ngày tải lên : 18/02/2014, 13:20
  • 16
  • 691
  • 0
Báo cáo khoa học: A novel splicing variant form suppresses the activity of full-length signal transducer and activator of transcription 5A pot

Báo cáo khoa học: A novel splicing variant form suppresses the activity of full-length signal transducer and activator of transcription 5A pot

... that aggregation of STAT 5A_ DE18 suppresses the tran- scriptional activity of STAT 5A. Discussion We isolated a novel STAT 5A splicing variant from the mouse brainstem. The STAT 5A_ DE18 variant lacked the transactivation ... activity of full-length signal transducer and activator of transcription 5A Yoshihisa Watanabe 1 , Masaya Ikegawa 2...
Ngày tải lên : 23/03/2014, 04:20
  • 12
  • 484
  • 0
Báo cáo khoa học: "Modification of pharmacokinetics of cefotaxime in uranyl nitrate-induced renal damage in black bengal goats" pps

Báo cáo khoa học: "Modification of pharmacokinetics of cefotaxime in uranyl nitrate-induced renal damage in black bengal goats" pps

...  6FLHQFH J. Vet. Sci. (2004), / 5 (1), 1–3 Modification of pharmacokinetics of cefotaxime in uranyl nitrate-induced renal damage in black bengal goats Biswa Priya Dutta, Shiben Chandra Debnath, ... available in kidney damaged goats. Therefore, the present study, investigates the alteration of disposition kinetics of cefotaxime in healthy and kidney damaged...
Ngày tải lên : 07/08/2014, 17:22
  • 3
  • 220
  • 0
Báo cáo khoa học: "Modification of pharmacokinetics of norfloxacin following oral administration of curcumin in rabbits" pps

Báo cáo khoa học: "Modification of pharmacokinetics of norfloxacin following oral administration of curcumin in rabbits" pps

... Modification of pharmacokinetics of norfloxacin following oral administration of curcumin in rabbits 295 Fig. 1. Semilogarithmic plot of plasma concentration-time p rofile of norfloxacin in control ... examine the influence of curcumin on the disposition profile of norfloxacin in rabbits after oral administration. The disposition of norfloxacin...
Ngày tải lên : 07/08/2014, 23:22
  • 5
  • 293
  • 0
báo cáo khoa học: " Patient- and delivery-level factors related to acceptance of HIV counseling and testing services among tuberculosis patients in South Africa: a qualitative study with " pdf

báo cáo khoa học: " Patient- and delivery-level factors related to acceptance of HIV counseling and testing services among tuberculosis patients in South Africa: a qualitative study with " pdf

... delivery-level factors related to acceptance of HIV counseling and testing services among tuberculosis patients in South Africa: a qualitative study with community health workers and program managers J ... program managers also pointed to a lack of appropriately trained staff members, as well as p oor infrastructure to monitor and deliver...
Ngày tải lên : 10/08/2014, 10:23
  • 10
  • 407
  • 0
báo cáo khoa học: " Modification of a neuronal network direction using stepwise photo-thermal etching of an agarose architecture" pptx

báo cáo khoa học: " Modification of a neuronal network direction using stepwise photo-thermal etching of an agarose architecture" pptx

... citation purposes) Journal of Nanobiotechnology Open Access Research Modification of a neuronal network direction using stepwise photo-thermal etching of an agarose architecture Ikurou Suzuki 1 , ... micro- chambers in a step-by-step fashion. This has helped us to understand the meaning of the spatial pattern of a neuro- nal network by comparing the chang...
Ngày tải lên : 11/08/2014, 00:22
  • 8
  • 179
  • 0
báo cáo khoa học: "Sub-cellular internalization and organ specific oral delivery of PABA nanoparticles by side chain variation" pdf

báo cáo khoa học: "Sub-cellular internalization and organ specific oral delivery of PABA nanoparticles by side chain variation" pdf

... and organ specific oral delivery of PABA nanoparticles by side chain variation. Journal of Nanobiotechnology 2011 9:10. Submit your next manuscript to BioMed Central and take full advantage of: ... entry into the food chain via eco-consumers. Efficiency of organ specific delivery of PABA nanomaterials by side chain variation in Drosophila To cate...
Ngày tải lên : 11/08/2014, 00:23
  • 12
  • 301
  • 0
báo cáo khoa học: " Mapping QTLs for oil traits and eQTLs for oleosin genes in jatropha" ppsx

báo cáo khoa học: " Mapping QTLs for oil traits and eQTLs for oleosin genes in jatropha" ppsx

... Access Mapping QTLs for oil traits and eQTLs for oleosin genes in jatropha Peng Liu, Chun Ming Wang * , Lei Li, Fei Sun, Peng Liu and Gen Hua Yue * Abstract Background: The major fatty acids in seed ... genes. Conclusions In conclusion, we identified 18 QTLs underlying the oil traits and 3 eQTLs of the oleosin acid genes. Among them, qC18:1-1, qOilC-...
Ngày tải lên : 11/08/2014, 11:21
  • 9
  • 205
  • 0
báo cáo khoa học: " Modification of tobacco plant development by sense and antisense expression of the tomato viroid-induced AGC VIIIa protein kinase PKV suggests involvement in gibberellin signaling" doc

báo cáo khoa học: " Modification of tobacco plant development by sense and antisense expression of the tomato viroid-induced AGC VIIIa protein kinase PKV suggests involvement in gibberellin signaling" doc

... tobacco plant development by sense and antisense expression of the tomato viroid-induced AGC VIIIa protein kinase PKV suggests involvement in gibberellin signaling Rosemarie W Hammond* and Yan ... PKV gene by antisense expression resulted in a taller stature and increased numbers of influorescences in transgenic plants. The combine...
Ngày tải lên : 12/08/2014, 03:21
  • 14
  • 224
  • 0
Báo cáo khoa học: "Intensive care unit delirium is an independent predictor of longer hospital stay: a prospective analysis of 261 non-ventilated patients" ppt

Báo cáo khoa học: "Intensive care unit delirium is an independent predictor of longer hospital stay: a prospective analysis of 261 non-ventilated patients" ppt

... non-venti- lated ICU patients. ã Even after adjustment for relevant covariates, delirium was found to be an independent predictor of longer hospital stay. While univariate analysis found an associ- ation ... to conduct this investigation. References 1. American Psychiatric Association: Diagnostic and Statistical Man- ual of Mental Disorders Washington, DC: American Psychi...
Ngày tải lên : 12/08/2014, 22:22
  • 7
  • 296
  • 0