Báo cáo khoa học: "An atypical case of respiratory actinobacillosis in a cow" pot

Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

... AATTCTCGAGTGCTGCTGCTGCCGTTGCTGC 6F-XHO AATTCTCGAGTGCTGCTGCTGCGAATGCTGC C3K -A7 K GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG HC-K 7A GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG MG3K6S GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC MG3K6S7K ... (5Â3Â) MA(9) ATATGGATCCATGGCTGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC MGA(8) ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC MG6...

Ngày tải lên: 16/03/2014, 16:20

12 512 0
Báo cáo khoa học: "An Empirical Evaluation of Probabilistic Lexicalized Tree Insertion Grammars*" potx

Báo cáo khoa học: "An Empirical Evaluation of Probabilistic Lexicalized Tree Insertion Grammars*" potx

... LTIGs) are tree- rewriting sys- tems, consisting of a set of elementary trees combined by tree operations. We distinguish two types of trees in the set of elementary trees: the initial trees and ... An empirical evaluation of probabilistic lexicalized tree insertion gram- mars. Technical Report 06-98, Harvard Uni- versity. Full Version. K. Lari and S.J. Young...

Ngày tải lên: 23/03/2014, 19:20

7 331 0
Báo cáo khoa học: "An Error Analysis of Relation Extraction in Social Media Documents" ppt

Báo cáo khoa học: "An Error Analysis of Relation Extraction in Social Media Documents" ppt

... Domain International AAAI Conference on Weblogs and Social Media Data Challenge Workshop. 2010. Klein D. and Manning C. Accurate Unlexicalized Pars- ing. Proceedings of the 41st Meeting of the ... Computational Linguistics An Error Analysis of Relation Extraction in Social Media Documents Gregory Ichneumon Brown University of Colorado at Boulder Boulder, Colorado bro...

Ngày tải lên: 30/03/2014, 21:20

5 396 0
Báo cáo khoa học: "An atypical case of respiratory actinobacillosis in a cow" pot

Báo cáo khoa học: "An atypical case of respiratory actinobacillosis in a cow" pot

... and pathological findings, and the surgical treatment of a case of atypical actinobacillosis in a cow. A 4-year-old female Jersey bovine who was not pregnant, and had been born and raised at ... giuliano.bettini@unibo.it An atypical case of respiratory actinobacillosis in a cow Peli Angelo 1 , Spadari Alessandro 1 , Romagnoli Noemi 1 , Bettini Giuliano 2,* ,...

Ngày tải lên: 07/08/2014, 23:22

3 348 0
báo cáo khoa học: "An operative case of hepatic pseudolymphoma difficult to differentiate from primary hepatic marginal zone B-cell lymphoma of mucosa-associated lymphoid tissue" ppt

báo cáo khoa học: "An operative case of hepatic pseudolymphoma difficult to differentiate from primary hepatic marginal zone B-cell lymphoma of mucosa-associated lymphoid tissue" ppt

... et al.: An operative case of hepatic pseudolymphoma difficult to differentiate from primary hepatic marginal zone B-cell lymphoma of mucosa-associated lymphoid tissue. World Journal of Surgical ... of Surgical Oncology 2011, 9:3 http://www.wjso.com/content/9/1/3 Page 8 of 8 CAS E REP O R T Open Access An operative case of hepatic pseudolymph...

Ngày tải lên: 09/08/2014, 01:24

8 255 0
báo cáo khoa học: "Littoral cell angioma of the spleen in a patient with previous pulmonary sarcoidosis: a TNF-α related pathogenesis?" pot

báo cáo khoa học: "Littoral cell angioma of the spleen in a patient with previous pulmonary sarcoidosis: a TNF-α related pathogenesis?" pot

... Littoral cell angioma of the spleen in a patient with hepatocellular carcinoma. J Formos Med Assoc 2005, 104:282-285. 15. Ercin C, Gurbuz Y, Hacihanefioglu A, Turgut Karakaya A: Multiple littoral cell angioma ... Bisceglia M, Sickel JZ, Giangaspero F, Gomes V, Amini M, Michal M: Littoral cell angioma of the spleen: an additional report of four cases with e...

Ngày tải lên: 09/08/2014, 02:21

4 619 0
Báo cáo khoa học: "An unusual case of low-grade tubulopapillary adenocarcinoma of the sinonasal tract" doc

Báo cáo khoa học: "An unusual case of low-grade tubulopapillary adenocarcinoma of the sinonasal tract" doc

... not for citation purposes) World Journal of Surgical Oncology Open Access Case report An unusual case of low-grade tubulopapillary adenocarcinoma of the sinonasal tract Ashish Bansal* 1 , Keloth ... Subse- quently, the patient had two further operations. Firstly, removal of the posterior aspect of the nasal septum was performed four months after removal of th...

Ngày tải lên: 09/08/2014, 07:21

3 239 0
Báo cáo khoa học: "Multi-visceral resection of pancreatic VIPoma in a patient with sinistral portal hypertension" docx

Báo cáo khoa học: "Multi-visceral resection of pancreatic VIPoma in a patient with sinistral portal hypertension" docx

... Central Page 1 of 6 (page number not for citation purposes) World Journal of Surgical Oncology Open Access Case report Multi-visceral resection of pancreatic VIPoma in a patient with sinistral portal ... literature. Aggressive resection of patients with advanced VIPoma neuroendocrine tumors has rarely been reported. Case presentation: A 46 year old women pres...

Ngày tải lên: 09/08/2014, 07:21

6 380 0
Báo cáo khoa học: "An ultrasonographic evaluation of skin thickness in breast cancer patients after postmastectomy radiation therapy" docx

Báo cáo khoa học: "An ultrasonographic evaluation of skin thickness in breast cancer patients after postmastectomy radiation therapy" docx

... < 0.025) in comparison to the non-irradiated skin thickness investigating chronic skin reactions. Patients with grade 2 acute skin toxicity presented with thinner skin as compared to patients ... al. Radiation Oncology 2011, 6:9 http://www.ro-journal.com/content/6/1/9 Page 3 of 10 RESEARCH Open Access An ultrasonographic evaluation of skin thickness in bre...

Ngày tải lên: 09/08/2014, 09:20

10 325 0
báo cáo khoa học: "An unusual case of suprascapular nerve neuropathy: a case report" pptx

báo cáo khoa học: "An unusual case of suprascapular nerve neuropathy: a case report" pptx

... the suprascapular or spinoglenoid notch. We present a puzzling case of a man with suprascapular nerve neuropathy that may have been associated with an appendectomy. The case was attributed to nerve ... CAS E REP O R T Open Access An unusual case of suprascapular nerve neuropathy: a case report Charalambos P Economides 1,2 , Loizos Christodoulou 3 , Theodoros...

Ngày tải lên: 10/08/2014, 23:20

3 278 0
báo cáo khoa học: " Paget’s disease of the breast in a male with lymphomatoid papulosis: a case report" doc

báo cáo khoa học: " Paget’s disease of the breast in a male with lymphomatoid papulosis: a case report" doc

... this article as: Fouad: Paget’s disease of the breast in a male with lymphomatoid papulosis: a case report. Journal of Medical Case Reports 2011 5:43. Submit your next manuscript to BioMed Central and ... invasion. Discussion Paget’s disease is an eczematous skin change of the nip- ple that is usually associated with an underlying breast malignancy [1...

Ngày tải lên: 11/08/2014, 00:22

3 1,1K 0
báo cáo khoa học: " Typical carcinoid tumor of the larynx in a woman: a case report" potx

báo cáo khoa học: " Typical carcinoid tumor of the larynx in a woman: a case report" potx

... CAS E REP O R T Open Access Typical carcinoid tumor of the larynx in a woman: a case report Fatma Tülin Kayhan * , Efser Gürer Başaran Abstract Introduction: Neuroendocrine tumors are the ... this article as: Kayhan and Başaran: Typical carcinoid tumor of the larynx in a woman: a case report. Journal of Medical Case Reports 2010 4:321. Submit...

Ngày tải lên: 11/08/2014, 02:21

4 224 0
báo cáo khoa học: "Squamous cell carcinoma of rectum presenting in a man: a case report" potx

báo cáo khoa học: "Squamous cell carcinoma of rectum presenting in a man: a case report" potx

... cell carcinoma 11 years after brachytherapy for carcinoma of the prostate. J Urol 2003, 169:280. 20. Jaworski RC, Biankin SA, Baird PJ: Squamous cell carcinoma in situ arising in inflammatory cloacogenic ... cell carcinoma of the rectum in the ethnic Kashmiri population in northern India. Case Presentation: The case of a 60-year-old male patient (Asian) wit...

Ngày tải lên: 11/08/2014, 02:22

6 363 0
w