Báo cáo khoa học: " Isolation and identification of a canine coronavirus strain from giant pandas (Ailuropoda melanoleuca)" ppt

Báo cáo khoa học: " Isolation and identification of a canine coronavirus strain from giant pandas (Ailuropoda melanoleuca)" ppt

Báo cáo khoa học: " Isolation and identification of a canine coronavirus strain from giant pandas (Ailuropoda melanoleuca)" ppt

... The pandas in this case study did not respond to anti-bacterial or anti-fungal therapy. However, the clinical Isolation and identification of a canine coronavirus strain from giant pandas 263 Fig. ... reports of CCV infection in pandas. In this study, we isolated a strain of CCV from two giant pandas, which suggests that pandas can be infected with C...

Ngày tải lên: 07/08/2014, 23:22

3 308 0
Báo cáo khoa học: "Isolation and identification of Escherichia coli O157:H7 using different detection methods and molecular determination by multiplex PCR and RAPD" docx

Báo cáo khoa học: "Isolation and identification of Escherichia coli O157:H7 using different detection methods and molecular determination by multiplex PCR and RAPD" docx

... CCTGTCAACTGAGCAGCACTTTG eae A- F GTGGCGAATACTGGCGAGACT 890 bp Fagan et al [14] eae A- R CCCCATTCTTTTTCACCGTCG hly A- F ACGATGTGGTTTATTCTGGA 165 bp Fagan et al [14] hly A- R CTTCACGTGACCATACATAT H7-F ... P010726-25, and O157-C-1-2), and 14 USA isolates; 4 strains of ATCC (A1 , A2 , A3 , and A4 ), 6 strains of Cornell University (C1, C2, C3, C4, C5, and C6), and 4 strai...

Ngày tải lên: 07/08/2014, 18:21

13 456 0
Báo cáo khoa học: Isolation and characterization of a D-cysteine desulfhydrase protein from Arabidopsis thaliana pptx

Báo cáo khoa học: Isolation and characterization of a D-cysteine desulfhydrase protein from Arabidopsis thaliana pptx

... Nagasawa T, Ohkishi H, Kawakami B, Yamano H, Hosono H, Tani Y & Yamada H (1982) 3-chloro-d-ala- nine chloride-lyase (deaminating) of Pseudomonas putida CR 1–1. Purification and characterization ... Isolation and characterization of a D-cysteine desulfhydrase protein from Arabidopsis thaliana Anja Riemenschneider, Rosalina Wegele, Ahlert Schmidt and Jutta Papenbrock Institut...

Ngày tải lên: 16/03/2014, 18:20

14 565 0
Báo cáo Y học: Isolation and characterization of a thioredoxin-dependent peroxidase from Chlamydomonas reinhardtii doc

Báo cáo Y học: Isolation and characterization of a thioredoxin-dependent peroxidase from Chlamydomonas reinhardtii doc

... protein of Brassica, spinach, barley and A. thaliana,PR1ofPhaseolus and MHF 9 of A. thaliana. These proteins b elong to the 2Cys-Prx subfamily. A ll plan t 2Cys-Prx proteins, except BAS1 of barley, ... were separated by HPLC and some of them were totally or partially analyzed by Edman sequencing and/ or by MALDI-TOF mass spectrometry ( Fig. 2). Computer database searches ba...

Ngày tải lên: 08/03/2014, 16:20

11 608 0
Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

... within the last 30 years. The greatest number of RIPs have been found in the Caryophyllaceae, Sambucaceae, Cucurbitaceae, Euphorbiaceae, Phytolaccaceae and Poaceae [1]. Although many are potentially ... sugars of three classes. Whereas agglutination was inhibited by galactose and its deriva- tives [such as N-acetylgalactosamine (GalNAc), methyl -a- d-galactopyranoside], it was evident...

Ngày tải lên: 18/02/2014, 16:20

12 763 0
Báo cáo khoa học: Isolation and characterization of an IgNAR variable domain specific for the human mitochondrial translocase receptor Tom70 potx

Báo cáo khoa học: Isolation and characterization of an IgNAR variable domain specific for the human mitochondrial translocase receptor Tom70 potx

... (Forward: 5¢-ACAAGGG TAGACCAAACACCAAGAACAGCAACAAAAGAG ACGGGCGAATCACTGACCATCAACgccGTCCTGA GAGAT-3¢) and N8518 (Reverse: 5¢-TTTCACGGTTAA TGCGGTGCCAGCTCCCCAACTGTAATAAATACC AGACAAATTATATGCTCCaacCCTATACGTGCCA CTG-3¢); ... linker and dual FLAG octa- peptide tags). Approximate elution times for a series of protein standards are indicated by arrows, and the absorbance at A 214 (unbroken l...

Ngày tải lên: 17/03/2014, 10:20

12 522 0
Báo cáo khóa học: Isolation and characterization of the Xenopus HIVEP gene family ppt

Báo cáo khóa học: Isolation and characterization of the Xenopus HIVEP gene family ppt

... an essential component of the TGF-b signaling pathway. In this study, we describe the isolation of Xenopus HIVEP1,aswell as partial cDNAs of HIVEP2 and -3. Analysis of the tem- poral and spatial expression ... HIVEP1,has also been isolated and characterized [14–16]. Typically, the large zinc finger (Znf) DNA binding proteins have a molecular mass greater than 250 kDa and co...

Ngày tải lên: 30/03/2014, 13:20

10 414 0
Báo cáo khoa học: " Isolation and characterization of canine umbilical cord blood-derived mesenchymal stem cells" pps

Báo cáo khoa học: " Isolation and characterization of canine umbilical cord blood-derived mesenchymal stem cells" pps

... 5´-AAGGGTAGGACGCTCCGTAT-3´), collagen 1A1 (COL 1A1 ) (sense, 5´-CACCTCAGGAGAAGGCTC AC-3´; antisense, 5´-ATGTTCTCGATCTGCTGGCT-3´), osteonectin (SPARC) (sense, 5´-TGAGAAGGTATGCAG CAACG; antisense, 5´-AGTCCAGGTGGAGTTTGTGG), ... mesenchymal stem cells have immunomodulatory capacities. Stem Cells Dev 2007, 16, 597-604. 14. Igura K, Zhang X, Takahashi K, Mitsuru A, Yamaguchi S, Takashi TA....

Ngày tải lên: 07/08/2014, 23:22

7 439 0
Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt

Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt

... GTT GGA ATT CCA TCA TCA TCA TCA TCA TCA GGG CAC GAC ACA CAT CCC C; and reverse primer, GAT CGG TAC CTC ATT ACA GAG GAG GGA TAT GGG GAA C. The PCR reaction was done as described above. The amplified ... T. reesei DNA with the following primers: forward, GGG GAC AAG TTT GTA CAA AAA AGC AGG CTA TCA TGC TGT TGT CAG GTC CCT CTC G; and reverse, GGG GAC CAC TTT GTA CAA GAA AGC TGG GTC A GT GGT...

Ngày tải lên: 19/02/2014, 06:20

14 651 0
w