Báo cáo khoa học: "Detection and molecular characterization of infectious bronchitis virus isolated from recent outbreaks in broiler flocks in Thailand" potx

Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx

Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx

... Y. Cai et al. 3584 FEBS Journal 276 (2009) 35753588 ê 2009 The Authors Journal compilation ê 2009 FEBS Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 Yuanheng ... subunit molecular mass was also estimated by SDS–PAGE. Characterization and comparative analyses of HYD Js and HYD Bp The optimal temperature for activi...

Ngày tải lên: 18/02/2014, 08:20

14 621 0
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

... 5Â-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3Â and a reverse oligomer 5Â-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3Â. For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the C-terminus ... addition to an N-terminal Nco1 cloning site. The forward o ligomer 5 Â-TCCGAAACCAGCG GCCGCTT TATCGCGTTA AAAC CGGT GATCAA ACCCC -3Â and the reverse oligomer 5Â-GTAGGCCTT...

Ngày tải lên: 19/02/2014, 06:20

10 648 0
Tài liệu Báo cáo khoa học: Bioinformatic and enzymatic characterization of the MAPEG superfamily doc

Tài liệu Báo cáo khoa học: Bioinformatic and enzymatic characterization of the MAPEG superfamily doc

... from the archaea kingdom, indicating that the enzymatic activities of the MAPEG family are not present in these species or that these activities are catalysed by other enzymes. The absence of MAPEG members ... [57]. Isolation and cloning of the SynMGST and E.coliMGST The coding sequence for the SynMGST, corresponding to the complementary strand of the nucle...

Ngày tải lên: 19/02/2014, 17:20

16 525 0
Tài liệu Báo cáo khoa học: Biochemical and molecular characterization of hazelnut (Corylus avellana) seed lipoxygenases pdf

Tài liệu Báo cáo khoa học: Biochemical and molecular characterization of hazelnut (Corylus avellana) seed lipoxygenases pdf

... organoleptic features of hazelnut seeds, we carried out a study to characterize hazelnut lipoxygenases at the biochemical and molecular level. Materials and methods Plant material Hazelnut (Corylus avellana ... physiological role of seed LOXs is still unclear. With the aim to better clarify the occurrence of LOXs and their influence on hazelnut seed quality, w...

Ngày tải lên: 21/02/2014, 00:20

11 404 0
Báo cáo khoa học: Assembly and molecular mode of action of the Helicobacter pylori Cag type IV secretion apparatus doc

Báo cáo khoa học: Assembly and molecular mode of action of the Helicobacter pylori Cag type IV secretion apparatus doc

... conserved and unique components of the Cag- T4SS, together with potential implications for the current understanding of its mode of action. The cagPAI and the Cag type IV secretion apparatus Gene ... 2011 The Author Journal compilation ê 2011 FEBS MINIREVIEW Assembly and molecular mode of action of the Helicobacter pylori Cag type IV...

Ngày tải lên: 06/03/2014, 00:21

10 393 0
Báo cáo khoa học: Kinetic and mechanistic characterization of Mycobacterium tuberculosis glutamyl–tRNA synthetase and determination of its oligomeric structure in solution pptx

Báo cáo khoa học: Kinetic and mechanistic characterization of Mycobacterium tuberculosis glutamyl–tRNA synthetase and determination of its oligomeric structure in solution pptx

... compilation ê 2009 FEBS 1401 Kinetic and mechanistic characterization of Mycobacterium tuberculosis glutamyl–tRNA synthetase and determination of its oligomeric structure in solution Stefano Paravisi 1 , ... minor, implying rotations of domains of just a few degrees (e.g. 7° interdomain rotations upon tRNA binding to the Tt-GluRS and local limited rear...

Ngày tải lên: 07/03/2014, 03:20

20 497 0
Báo cáo khóa học: Biochemical and molecular characterization of a laccase from the edible straw mushroom, Volvariella volvacea docx

Báo cáo khóa học: Biochemical and molecular characterization of a laccase from the edible straw mushroom, Volvariella volvacea docx

... various fungal laccases. 326 S. Chen et al. (Eur. J. Biochem. 271) Ó FEBS 2003 Biochemical and molecular characterization of a laccase from the edible straw mushroom, Volvariella volvacea Shicheng ... one other laccase isoform in addition to lac1 [1], this and possibly other laccase isoforms may be contributing to the total laccase activity detected at...

Ngày tải lên: 07/03/2014, 15:20

11 703 0
Báo cáo khoa học: Isolation and enzymatic characterization of lamjapin, the first ribosome-inactivating protein from cryptogamic algal plant (Laminaria japonica A) ppt

Báo cáo khoa học: Isolation and enzymatic characterization of lamjapin, the first ribosome-inactivating protein from cryptogamic algal plant (Laminaria japonica A) ppt

... protocol of RIP purification. As Fig. 1 shown, the CM-cellulose 52 column retained the most of the RIP activity and also separated the lamjapin from the other impurities. The proteins obtained from the ... pooled and subjected to further purification. 4748 R s. Liu et al. (Eur. J. Biochem. 269) Ó FEBS 2002 Isolation and enzymatic characterization of lamjapi...

Ngày tải lên: 08/03/2014, 10:20

7 480 0
Báo cáo khoa học: Functional and genetic characterization of the promoter region of apolipoprotein H (b2-glycoprotein I) ppt

Báo cáo khoa học: Functional and genetic characterization of the promoter region of apolipoprotein H (b2-glycoprotein I) ppt

... the functional roles of the )643T>C and )1219G>A SNPs as part of the extended APOH promoter transcriptional machinery. To further substantiate the functional relevance of the three APOH promoter ... quantitative change at the protein level. Whether the APOH pro- moter SNPs ( )643T>C and )1219G>A) could influ- ence the promoter activity by either...

Ngày tải lên: 15/03/2014, 10:20

13 404 0
Báo cáo khoa học: Functional and structural characterization of novel mutations and genotype–phenotype correlation in 51 phenylalanine hydroxylase deficient families from Southern Italy docx

Báo cáo khoa học: Functional and structural characterization of novel mutations and genotype–phenotype correlation in 51 phenylalanine hydroxylase deficient families from Southern Italy docx

... characterization of novel mutations and genotype–phenotype correlation in 51 phenylalanine hydroxylase deficient families from Southern Italy Aurora Daniele 1,2,3 , Iris Scala 4 , Giuseppe Cardillo 1,5 , Cinzia ... analysis of the PAH gene in 51 unrelated HPA patients from South- ern Italy. In addition to the molecular epidemiology of PAH mutations...

Ngày tải lên: 16/03/2014, 01:20

12 491 0
Báo cáo khoa học: Structural and functional characterization of human Iba proteins ppt

Báo cáo khoa học: Structural and functional characterization of human Iba proteins ppt

... cross-linking efficiency of Iba1 and Iba2 or in the overall morphology of the generated filament bundles. Calcium affinity of Iba1 and Iba2 Homodimerization and actin binding of Iba1 and Iba2 were similar ... presented here reveals functional simi- larities and differences between Iba1 and Iba2 . We investigated Ca 2+ binding and homodimerization of Iba1 and...

Ngày tải lên: 16/03/2014, 06:20

14 546 0
Báo cáo khoa học: Biochemical and molecular characterization of purified chicken pancreatic phospholipase A2 docx

Báo cáo khoa học: Biochemical and molecular characterization of purified chicken pancreatic phospholipase A2 docx

... FEBS Biochemical and molecular characterization of purified chicken pancreatic phospholipase A 2 Aida Karray, Fakher Frikha, Abir Ben Bacha, Yassine Ben Ali, Youssef Gargouri and Sofiane Bezzine Laboratoire ... zymogen of phospholipase A in human pancreatic juice. Biochim Biophys Acta 227, 213–217. 12 Evenberg A, Meyer H, Verheij HM & de Haas GH (1977) Isolation...

Ngày tải lên: 30/03/2014, 01:20

10 359 0
Báo cáo khoa học: "Identification and epidemiological characterization of Streptococcus uberis isolated from bovine mastitis using conventional and molecular methods" pdf

Báo cáo khoa học: "Identification and epidemiological characterization of Streptococcus uberis isolated from bovine mastitis using conventional and molecular methods" pdf

... uberis strain Identification and epidemiological characterization of Streptococcus uberis isolated from bovine mastitis 223 studies on Streptococcus uberis types I and II. Description of Streptococcus ... cloning of a streptokinase from Streptococcus uberis . Infect. Immun. 1999, 67 , 1072-1078. Identification and epidemiological characterizatio...

Ngày tải lên: 07/08/2014, 17:22

11 508 0
Báo cáo khoa học: "Detection and molecular characterization of infectious bronchitis virus isolated from recent outbreaks in broiler flocks in Thailand" potx

Báo cáo khoa học: "Detection and molecular characterization of infectious bronchitis virus isolated from recent outbreaks in broiler flocks in Thailand" potx

... strain of infectious bronchitis virus isolated in the UK. Vet Rec 2008, 162, 99-100. 11. Gough RE, Randall CJ, Dagless M, Alexander DJ, Cox WJ, Pearson D. A ‘new’ strain of infectious bronchitis ... region of the S1 gene of infectious bronchitis virus. Arch Vrol 2000, 145, 291-300. 21. Yu L, Wang Z, Jiang Y, Low S, Kwang J. Molecular epidemiology of infectio...

Ngày tải lên: 07/08/2014, 23:22

5 538 0
Báo cáo khoa học: " Complete genomic sequence analysis of infectious bronchitis virus Ark DPI strain and its evolution by recombination" pot

Báo cáo khoa học: " Complete genomic sequence analysis of infectious bronchitis virus Ark DPI strain and its evolution by recombination" pot

... Abstract An infectious bronchitis virus Arkansas DPI (Ark DPI) virulent strain was sequenced, analyzed and compared with many different IBV strains and coronaviruses. The genome of Ark DPI consists of 27,620 ... 1 of 7 (page number not for citation purposes) Virology Journal Open Access Short report Complete genomic sequence analysis of infectious bronc...

Ngày tải lên: 12/08/2014, 04:21

7 243 0
w