Báo cáo khoa học: "Low dietary inorganic phosphate affects the lung growth of developing mice" pps

Tài liệu Báo cáo khoa học: Ionic strength and magnesium affect the speciﬁcity of Escherichia coli and human 8-oxoguanine-DNA glycosylases pdf

... Factors affecting the speciﬁcity of Fpg and OGG1FEBS Journal 275 (2008) 3747–3760 ª 2008 The Authors Journal compilation ª 2008 FEBS 3755 Ionic strength and magnesium affect the speciﬁcity of Escherichia ... independently evaluate the effects of ionic strength and Mg2+on the activity and speciﬁcity of OGG1, we measured the apparent values of k2 and k3under conditions of low salt (KPionly) and no Mg2+,low ... compo-sition, ionic strength, Mg2+concentration and severalother factors.ResultsEffects of ionic strength and divalent cations on the activity and speciﬁcity of Fpg and OGG1 The conditions inside...

Tài liệu Báo cáo khoa học: "Enhanced word decomposition by calibrating the decision threshold of probabilistic models and using a model ensemble" pdf

... probabilistically combine ParaMor(Monson, 2008) and Morfessor (Creutz, 2006).They used a natural language tagger which wastrained on the output of ParaMor and Morfes-sor. The goal was to mimic each algorithm ... PROMODES-Edirectly accesses the probabilistic framework of each algorithm and combines them based on anoptimal threshold learnt on a validation set.5 ConclusionsWe have presented a method to learn a cali-brated ... fu-sional and agglutinating languages. IEEE Transac-tions on Audio, Speech, and Language Processing,17(5):956965.M. G. Snover and M. R. Brent. 2001. A Bayesian model for morpheme and paradigm...

Báo cáo khoa học: Nanoparticles can induce changes in the intracellular metabolism of lipids without compromising cellular viability docx

... QDs can induce signaling implicated in the response to hypoxia and can reduce the rate of fat oxidation in PC12 cellsWe hypothesized that QDs and CoCl2 induce the accu-mulation of lipids in ... Nanoparticle-induced metabolic changes FEBS Journal 276 (2009) 6204–6217 ª 2009 The Authors Journal compilation ª 2009 FEBS 6209 Nanoparticles can induce changes in the intracellular metabolism of lipids ... NPs can affect the intracellular metabolism of lipids and induce HIF-1a-mediated signaling. The results suggest that QDs, together with trophic factors,promote the accumulation of lipids in cytoplasmicLDs,...

Báo cáo khoa học: C ﬁ G base mutations in the CArG box of c-fos serum response element alter its bending ﬂexibility Consequences for core-SRF recognition potx

... SREfos5Â-d(GGATGTCCATATTAGGACAT)-3Â reproduces the sequence of the SRF recog-nition element of the c- fos enhancer [2,27]. The mut-ants SREGfos5Â-d(GGATGTgCATATTAGGACAT)-3Â andSREGGfos5Â-d(GGATGTggATATTAGGACAT)-3Â ... ê 2007 The Authors Journal compilation ê 2007 FEBS 2339 C ﬁ G base mutations in the CArG box of c- fos serum response element alter its bending ﬂexibility Consequences for core-SRF recognition Josef ... various interac-tions connecting the bases of the CArG box play the key role in the physiological activity of DNA.Experimental proceduresOligonucleotides The oligonucleotide SREfos5Â-d(GGATGTCCATATTAGGACAT)-3Â...

Báo cáo khoa học: Structural and thermodynamic insights into the binding mode of ﬁve novel inhibitors of lumazine synthase from Mycobacterium tuberculosis pptx

... compilation ê 2006 FEBS 4793 Structural and thermodynamic insights into the binding mode of ﬁve novel inhibitors of lumazine synthase from Mycobacterium tuberculosis Ekaterina Morgunova1, Boris ... range. The analysis of the struc-tures demonstrated the speciﬁc features of the binding of different inhibi-tors. The comparison of the structures and binding modes of ﬁve different inhibitors ... for comparison of binding afﬁnities of the inhibitors under study. The ﬁtting of the binding isotherms of all ﬁve com-pounds with a binding model assuming identical and independent binding sites...

Báo cáo khoa học: A ribonuclease zymogen activated by the NS3 protease of the hepatitis C virus potx

... ribonucleolytic activity and RIafﬁnity of unactivated and activated 1C zymogen withthose of other RNase A variants, we can estimate the therapeutic potential of an HCV RNase A zymogen. Unactivated 1C zymogen ... Physicochemical properties of a ribonuclease A zymogen. Ribonuclease (Tm)unactivated a ( C) (Tm) activated a ( C) (Kd)unactivatedb(nM)(Kd) activated b(nM)(IC50)unactivated c (lM)Wild-type ... Kdvalues for the complexes of pRIFig. 4. Conformation and conformational stability of unactivated (d)and activated (s) 1C zymogens assessed by CD. (A) Near-UV CDspectra of unactivated and activated...

Báo cáo khoa học: DNA polymerase e associates with the elongating form of RNA polymerase II and nascent transcripts pot

... eukary-otic cell [22]. Therefore, we tested the effect of the replicative state of the cell on the interaction betweenPol e and RNA pol II. A possible conﬁnement of the interaction to late G1 and S ... co-operates with polymerases a and d in the replicative DNA synthesis of eukaryotic cells. We describe here a speciﬁc physicalinteraction between DNA polymerase e and RNA polymerase II, evidencedby ... comprises tandem heptapeptide repeats of the Keywords DNA polymerase e; DNA replication;immunoelectron microscopy; nucleotideexcision repair; RNA polymerase II CorrespondenceH. Pospiech, Department...

Báo cáo khoa học: Akt-dependent phosphorylation negatively regulates the transcriptional activity of dHAND by inhibiting the DNA binding activity pdf

... the DNA binding activity of dHAND could beaffected by Akt phosphorylation. The inﬂuence of phos-phorylation by Akt on the DNA binding activity wasexamined by gel shift analysis. We included the ... phosphorylation of dHAND decreased the transcriptional a ctivity of dHAND/ E47heterodimer.Fig. 6. The eﬀects of A kt expression on the transcriptional activity of dHAND. (A) AU5-d HAND, -dHAND- Ala-X, -dHAND- Ala, ... al.(Eur. J. Biochem. 271) Ó FEBS 2004 Akt-dependent phosphorylation negatively regulates the transcriptional activity of dHAND by inhibiting the DNA binding activity Masao Murakami1,2, Keiichiro...

Báo cáo khoa học: Homoadenosylcobalamins as probes for exploring the active sites of coenzyme B12-dependent diol dehydratase and ethanolamine ammonia-lyase docx

... usethem as probes for exploring the active sites of enzymes, the coenzymicproperties of homoadenosylcobalamins for diol dehydratase and ethanol-amine ammonia-lyase were investigated. The kcat and ... [24] and AdoEtCbl[29] were reported to be totally inactive as coenzyme for ribonucleotide reductase, and the latter inactive for diol dehydratase [27]. The X-ray structure of the diol dehydratase AdePeCbl ... of homoadenosylcobalamins FEBS Journal 272 (2005) 47874796 ê 2005 FEBS 4789 Homoadenosylcobalamins as probes for exploring the active sites of coenzyme B12-dependent diol dehydratase and ethanolamine...

Báo cáo khoa học: Proteoglycans in health and disease: the multiple roles of syndecan shedding ppt

... enhances shedding of syndecan- 1 through a-toxin and b-toxin [58]. Beta-toxin, but not a-toxin, alsomediates shedding of syndecan- 4. Alpha- and b-toxinsdo not directly trigger syndecan- 1 shedding, ... full-length TIMP-1 and TIMP-3 are [31]. The C-terminal domain of TIMPs can stabilize proMMPby binding to its hemopexin domain, leaving the N-ter-minal fully capable of interacting with other MMPs.Most ... [75].A key in ammatory response is chemokine-mediatedrecruitment of leukocytes into sites of in ammation[76]. Many chemokines bind HS chains of syndecans and evoke MMP-mediated shedding of syndecans...

Báo cáo khoa học: Low U1 snRNP dependence at the NF1 exon 29 donor splice site doc

... using the following oligonucleo-tides: NF29-F, 5Â-ttcattcatatgaccatttgaatatacaatggt-3Â; andNF29-R, 5Â-aagtaacatatgatggagaaaggacatatat-3Â. Both oli-gonucleotides carry an Nde1 site in their ... the original IVS29 context (see below).Interaction between U1 snRNP and IVS29 donor sitesWe then decided to investigate the ability of all these donor sites to bind U1 snRNA /U1 snRNP directly,under ... between U1 snRNA and the IVS29 donor site sequences, there also remained the possibility that U1 snRNP might still be recruited to the IVS29 donor site by other indirect interactions. Moreover, the...

Báo cáo khoa học: Key substrate recognition residues in the active site of a plant cytochrome P450, CYP73A1 ppt

... 5Â-GAAGTTAAAGATACAATGATTCAGCTC 5Â-GAGCTGAATCATTGTAACTTTAACTTC-3Â 48N302D 5Â-CATTGTTGAAGACATCAATGTTG-3Â 5Â-CAACATTGATGTCTTCAACAATG-3Â 43N302F 5Â-CTTTACATTGTTGAATTCATCAATGTTGCAGC-3Â 5Â-GCTGCAACATTGATGAATTCAACAATGTAAAG-3Â ... 5Â-CAACATTCCTTGTCATCGAACCAAACTC-3Â 58R103M 5Â-GTTCGAGAACAATGAATGTTGTGTTC-3Â 5Â-GAACACAACATTCATTGTTCTCGAAC-3Â 55R103E 5Â-GAACACAACATTCTCTGTTCTCGAACC-3Â 5Â-GGTTCGAGAACAGAGAATGTTGTGTTC-3Â 55DKR 5Â-GAAGTTAAAGATACAATGATTCAGCTC ... 5Â-TCCGTATGGCGGCTCCGCTTCTAGTC-3Â 5Â-GACTAGAAGCGGAGCCGCCATACGGA-3Â 58I371K 5Â-TCCGTATGGCGAAACCGCTTCTAGTC-3Â 5Â-GACTAGAAGCGGTTTCGCCATACGGA-3Â 58K484M 5Â-GATACCGATGAGATGGGTGGGCAGTTTAG-3Â 5Â-CTAAACTGCCCACCCATCTCATCGGTATC-3Â...

Báo cáo khoa học: Alternative binding proteins: Anticalins – harnessing the structural plasticity of the lipocalin ligand pocket to engineer novel binding activities pdf

... 2008 The Author Journal compilation ê 2008 FEBS MINIREVIEW Alternative binding proteins: Anticalins – harnessing the structural plasticity of the lipocalin ligand pocket to engineer novel binding ... supported by the structurally rigid b-sandwich framework of the pairedvariable domains of the light and heavy chains. TheseCDRs come together at the tips of the Y-shaped mole-cule to form a contiguous ... for both anticalins, the set of four loops at the entrance to the ligand pocket exhibited pronouncedconformational differences in comparison with eachother and with the BBP. These structural...

Báo cáo khoa học: "Low dietary inorganic phosphate affects the lung growth of developing mice" pps

... termed the ‘Guardian of the Genome’ [14], and so Effects of low inorganic phosphate on lung of developing mice 111Fig. 5. Analysis of fibroblast growth factor 2 (FGF-2) protein in the lungs of ... expression in the lung [6,17]. Together, the potential importance of Pi, as a novel signaling molecule, and the pulmonary expression of NPTs together with the poor prognosis of many diverse lung diseases ... Pi suppressed the protein expression of NPT-2b in the lungs of developing mice, and this suggests that low dietary uptake of Pi for a critical period may disturb the function of lung. In fact,...

Báo cáo khoa học: "Plasma Calcium, Inorganic Phosphate and Magnesium During Hypocalcaemia Induced by a Standardized EDTA Infusion in Cows" docx

... studies.Na2 EDTA; induce.Acta vet. scand. 2001, 42, 251-260.Acta vet. scand. vol. 42 no. 2, 2001Plasma Calcium, Inorganic Phosphate and Magnesium During Hypocalcaemia Induced by a Standardized EDTA ... inorganic phosphate and magnesium during hypocalcaemia induced by a standardized EDTA infusion in cows. Acta vet. scand. 2001, 42, 251-260. – The intravenous Na2 EDTA infusion technique allows ... concentration trends for total calcium, inorganic phosphate and magnesium during a standardized intravenous EDTA infusion fol-lowing a 10 day of anion salt supplementationto cows. Plasma total calcium...

Xem thêm