Báo cáo khoa học: "Three-dimensional CT angiography of the canine hepatic vasculature" pdf

... Three-dimensional CT angiography of the canine hepatic vasculature 413 quickly with excellent spatial resolution [6]. The use of MDCT can overcome the limitations of hepatic CTA that occur with the use of ... investigated. The objectives of this study are 1) to develop the CTA technique for imaging of the canine hepatic vasculature and 2) to describe...

Ngày tải lên: 07/08/2014, 23:22

... independently of Pbx, and does not possess the autoinhibitory function of the Hth domain. In summary, our data suggest that one function of the conserved Hth domain is to inhibit the activity of the transcriptional ... Meis2d transcriptional activity, as would be expected if they affected the inhibitory function of the Hth domain. To verify that the Pbx1 interaction...

Ngày tải lên: 16/02/2014, 15:20

... advantage of p53 mutation analysis, and a unique feature of this database, is the availabil- ity of the residual activity of the majority of p53 mis- sense mutants. The biological activity of mutant ... on how much the mutant affects the activity of the pro- tein. Further information can be gathered by consider- ing which parameters have the largest contribution...

Ngày tải lên: 18/02/2014, 11:20

... obtained with the transition at posi- tions 1915 and 1917. These mutations had an effect on the formation of pseudouridine exclusively at the mutant position and did not affect either of the other two ... RluD is active in the absence of DeaD. 23S rRNA in the 40S and 50S particles shows only traces of RluD specific Y residues (Fig. 5). 50S particles of the deaD – strain...

Ngày tải lên: 18/02/2014, 16:20

... assays. The graphs show the basal constitutive activity, the activity of BPA (1 and 10 l M) for the basal constitutive activity, the inverse agonist activity of 4-OHT (1 and 10 l M) for the basal ... the cells were trea- ted with a vehicle solution to measure the basal con- stitutive activity of each receptor, by using exactly the same of amount of expression plasm...

Ngày tải lên: 18/02/2014, 16:20

... CCGCTCGAGCGGCTATCTATCTATTGTTCTTGCTTCCCAGCACC 13 (F) GGAATTCCATATGCAGAGTGATAAAAACGCTAACGTCT (R) CCGCTCGAGCGGCTATCTATCTAATACGAATCTTGAGCTTTCTTTTC 14 (F) GGAATTCCATATGCAGAGTGATAAAAACGCTAACGTCT (R) CCGCTCGAGCGGCTATCTATCTATTTTGTCTTCATTTTTTCCTTACTTTC 15 ... CCGCTCGAGCGGCTATCTATCTATTTTGTCTTCATTTTTTCCTTACTTTC 15 (F) GGAATTCCATATGCAGAGTGATAAAAACGCTAACGTCT (R) CCGCTCGAGCGGCTATCTATCTACTCCTTCTTATGCCCCGCC...

Ngày tải lên: 19/02/2014, 00:20

... affect the structure and the functional properties of the protein, as the con- served lysine-rich domain around the solvent-exposed heme edge is involved in the interaction with redox partners. The ... blue-shift of the CT band from 618 to 616 nm (spectrum b of Fig. 8A). The slow phase is instead characterized by a marked enhancement of the absorbance band center...

Ngày tải lên: 19/02/2014, 05:20

... formed irrespective of the presence of reductant (Fig. 5). The difference in TH activity of nfeAFP13 in the presence and absence of dithiothreitol (Fig. 6) implies that the TH activity of the monomer ... is similar to the case of the QAE2 isoform, nfeAFP13; the activity of its monomer was enhanced by the pres- ence of a small amount of the multimer. Altho...

Ngày tải lên: 19/02/2014, 16:20

... consequence of the time delay in the enzymatic chain. Subtraction of the rate of the cystathionine b-lyase side reaction from the total rate of NADH oxidation yielded the actual rate of cystathionine ... in terms of the number of the enzymes involved, the kinetic mechanisms of the competing enzymes and the number as well as the nature of the alloste...

Ngày tải lên: 20/02/2014, 02:21

... relation extraction efforts have over- looked the ontological distinctions between the different types of part-whole relations. They as- sume the existence of a single relation, subsuming the different ... spe- cific types of part-whole relations (member -of, sub-quantity -of, contained-in, structural part -of and located-in), and for the general set composed of all types....

Ngày tải lên: 20/02/2014, 04:20