... TCTTTGACTTCTCAAACTGATCG RPE6 5a- His-Fwd NM_200751 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC RPE65c-His-Fwd NM_001113653 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC Y. Takahashi ... subcellular fractionation To analyze the cellular localization of zebrafish RPE65c in the retina, we generated an antibody using a specific zebrafish RPE65c peptide, and the specifici...
Ngày tải lên: 14/02/2014, 14:20
... B plays an important role in the membrane- blebbing pro- cess [19 ], DAPK -1 and s-DAPK -1 may be able to inter- act with ankyrin B via their ankyrin repeats and thus promote membrane blebbing. Although ... tail on the membrane- blebbing- promoting ability of s-DAPK -1, the localization and half-lives of the full-length s-DAPK -1, s-DAPK-1Dtail and s-DAPK- 1G296AR29 7A we...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: "An alternative LR algorithm for TAGs" docx
... Abstract We present a new LR algorithm for tree- adjoining grammars. It is an alternative to an existing algorithm that is shown to be incorrect. Furthermore, the new algorithm is much sim- pler, ... incorrectness have been given before by Kinyon (1997). There seems to be no straightforward way to correct the algorithm. We therefore developed an alternative to the al...
Ngày tải lên: 20/02/2014, 18:20
Tài liệu Báo cáo khoa học: "An Alternative Conception of Tree-Adjoining Derivation*" ppt
... re- defining tree-adjoining derivation.) An Alternative Conception of Tree-Adjoining Derivation* Yves Schabes Department of Computer and Information Science University of Pennsylvania ... Shieber. 1992. An alternative conception of tree-adjoining deriva- tion. Technical Report 08-92, Harvard Univer- sity. Yves Schabes. 1991. Computational and mathematical stud...
Ngày tải lên: 20/02/2014, 21:20
Báo cáo khoa học: A (1fi3)-b-D-glucan recognition protein from the sponge Suberites domuncula Mediated activation of fibrinogen-like protein and epidermal growth factor gene expression pot
... analyzed. The canals (ca) of the aquiferous system are lined by an epithelial layer formed from pinacocytes. Magnifications: A- a and B -a, · 25; A- b and B-b, · 50; A- c and B-c, · 100. Ó FEBS 2004 Activation ... recognition protein from the sponge Suberites domuncula Mediated activation of fibrinogen-like protein and epidermal growth factor...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo Y học: An alternative model for photosystem II/light harvesting complex II in grana membranes based on cryo-electron microscopy studies pptx
... Biochemistry 38, 2233±2239. 336 R. C. Ford et al. (Eur. J. Biochem. 269) Ó FEBS 2002 An alternative model for photosystem II/ light harvesting complex II in grana membranes based on cryo-electron microscopy ... chlorophyll and carotenoid (pigments) bound in side thylakoid mem- brane proteins. For photosystem II (PSII) in plants, light energy is main...
Ngày tải lên: 17/03/2014, 17:20
báo cáo hóa học: " Mild solutions for a problem involving fractional derivatives in the nonlinearity and in the non-local conditions" ppt
... RESEARCH Open Access Mild solutions for a problem involving fractional derivatives in the nonlinearity and in the non-local conditions Nasser-eddine Tatar Correspondence: tatarn@kfupm. edu.sa Department ... Methods in Mathematical Analysis. Transaction on Mathematical Monographs, American Mathematical Society, Providence 1964, 12. 14. Hughes DK: Variational an...
Ngày tải lên: 21/06/2014, 02:20
Báo cáo hóa học: "Research Article A Hardy Inequality with Remainder Terms in the Heisenberg Group and the Weighted Eigenvalue Problem" docx
... Journal of Inequalities and Applications [9] J.L.V ´ azquez and E. Zuazua, The Hardy inequality and the asymptotic behaviour of the heat equation with an inverse-square potential,” Journal of ... other eigenvalues change sign. Our proof is mainly based on a Hardy inequality with remainder terms. It is established by the vec- tor field method and an elementary in...
Ngày tải lên: 22/06/2014, 11:20
Báo cáo hóa học: "Research Article A Hardy Inequality with Remainder Terms in the Heisenberg Group and the Weighted Eigenvalue Problem" pot
... Applications Volume 2007, Article ID 32585, 24 pages doi:10.1155/2007/32585 Research Article A Hardy Inequality with Remainder Terms in the Heisenberg Group and the Weighted Eigenvalue Problem Jingbo ... Ω, then the constant C Q,p is best. In this section, we give the Hardy inequality with remainder terms on Ω, based on the careful Hindawi Pu...
Ngày tải lên: 22/06/2014, 11:20
Báo cáo toán học: "On edge colorings with at least q colors in every subset of p vertices" ppsx
... behavior of f(n, p, q) between the linear and quadratic orders of magnitude, so for q lin ≤ q ≤ q quad . In particular we show that that we can have at most log p values of q which give a linear ... denotes the parity of the natural number n,soitis1ifn is odd and 0 otherwise. 1.2 Edge colorings with at least q colors in every subset of p vertice...
Ngày tải lên: 07/08/2014, 07:21
Báo cáo toán học: "An alternative definition of the notion valuation in the theory of near polygons" pot
... E 1 are the points of PG(6, 3) \ PG(5, 3); (ii) the lines of E 1 are the lines of PG(6, 3), not contained in PG(5, 3), which contain a point of K; (iii) incidence is derived from the one of PG(6, ... point x of PG(5, 3), define the generating index i K (x) of x as the minimal number of points of K which are necessary to generate a subspace containing x. Lemma 4....
Ngày tải lên: 07/08/2014, 21:21
Báo cáo khoa học: "Bench-to-bedside review: Treating acid–base abnormalities in the intensive care unit – the role of renal replacement therapy" potx
... associated with ARF often leads to acidemia. Furthermore, persistent Review Bench-to-bedside review: Treating acid–base abnormalities in the intensive care unit – the role of renal replacement therapy Toshio ... acid–base disorders. Therefore, improving our understanding of the impact of RRT on acid–base disor- ders and gaining insights into the nat...
Ngày tải lên: 12/08/2014, 20:20
Báo cáo khoa học: "Bench-to-bedside review: Treating acid–base abnormalities in the intensive care unit – the role of buffers" ppt
... way of example, consider the effect of decreasing blood flow to a tissue by 50%. According to the Review Bench-to-bedside review: Treating acid–base abnormalities in the intensive care unit – the ... into different acid–base consequences. For example, infusing large volumes of normal saline intravenously lowers the [SID] (because the [SID] of saline i...
Ngày tải lên: 12/08/2014, 20:20
Báo cáo y học: "An artificial intelligence tool to predict fluid requirement in the intensive care unit: a proof-of-concept study" docx
... data. This is the benchmark to compare it against a p value. The simplest relation between p values and Bayes factors are based on a Gaussian approximation. In that situation, the Bayes factor ... terms of age, gender, ethnicity, admitting diag- Figure 3 Artificial intelligence at the point-of -care in the ICUArtificial intelligence at the point-of -care in th...
Ngày tải lên: 13/08/2014, 11:23
Báo cáo y học: "Two devils: hypernatremia and hyponatremia can show faces to the same patient in the intensive care unit" pps
... Ahmed SB, Khandwala F, Zygun D, Shahpori R, Laup- land K: The epidemiology of intensive care unit-acquired hypo- natremia and hypernatremia in medical–surgical intensive care units. Crit Care 2008, ... Critical Care Vol 13 No 2 Eghtesadi-Araghi et al. Page 2 of 2 (page number not for citation purposes) Competing interests The authors declare that they have no competing i...
Ngày tải lên: 13/08/2014, 15:21