Báo cáo khoa học: "Molecular characterization and genogrouping of VP1 of aquatic birnavirus GC1 isolated from rockfish Sebastes schlegeli in Korea" potx
Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding specificity and target candidates doc
... greatnumber of Arabidopsis transcripts are potential targetsfor regulation by the PUF family of proteins. Theresults obtained reveal a molecular conservation of PUF proteins in Arabidopsis thaliana and ... in Arabidopsis FEBS Journal 276 (2009) 54565470 ê 2009 The Authors Journal compilation ê 2009 FEBS 5461 Molecular characterization of Arabidopsis thaliana PUF proteins – binding specificity and ... the binding specificity of the subset of groupI APUM proteins, showing that A. thaliana has at leastsix PUF proteins with conserved RNA -binding and similar specificity. The group I APUM proteins...
- 15
- 586
- 0
Tài liệu Báo cáo khoa học: Molecular cloning and characterization of soybean protein disulfide isomerase family proteins with nonclassic active center motifs pdf
... Journal compilation ê 2009 FEBS 4135 Molecular cloning and characterization of soybean protein disulfide isomerase family proteins with nonclassic active center motifs Kensuke Iwasaki1, Shinya ... (2008) A novelplant protein disulfide isomerase family homologous toanimal P5 – molecular cloning and characterization as afunctional protein for folding of soybean seed-storage proteins. FEBS J ... 2009)doi:10.1111/j.1742-4658.2009.07123.x Protein disulfide isomerase (PDI) and other PDI family proteins are mem-bers of the thioredoxin superfamily and are thought to play important rolesin disulfide bond formation and isomerization...
- 12
- 622
- 0
Tài liệu Báo cáo khoa học: Molecular modeling and functional characterization of the monomeric primase–polymerase domain from the Sulfolobus solfataricus plasmid pIT3 doc
... with the 1–245 N-terminal domain of the putative replica-tion protein from the S. solfataricus plasmid pIT3. Furthermore, a longer variant (Rep516) comprising the 1–516 N-terminal residues of the ... tri -functional monomeric primase–polymerase domain encoded by the plasmid pIT3 from Sulfolobus solfataricus strain IT3 was identified using astructural functional approach. The N-terminal domain ... describe the structure–functionanalysis of a 1–245 N-terminal domain of the puta-tive replication protein encoded by the pIT3 plasmid from S. solfataricus, the shortest fully functional prim–pol domain...
- 14
- 620
- 0
Tài liệu Báo cáo khoa học: Molecular characterization, phylogenetic relationships, and developmental expression patterns of prion genes in zebrafish (Danio rerio) doc
... 2004 FEBS Molecular characterization, phylogenetic relationships, and developmental expression patterns of prion genes in zebrafish (Danio rerio) Emmanuelle Cotto1,2, Miche`le Andre´1, ... mammalian origin by the fish intestine.Comparison of zebrafish prp1, prp2, and prp3 developmental expression patterns The developmental expression patterns of prp1 and prp2 coding for long zebrafish ... mis-folded form of a prion protein (PrP) encoded by the Prnp gene in humans. In the present study in zebrafish, two transcripts and the corresponding genes encoding prion proteins, PrP1 and PrP2, related...
- 14
- 547
- 0
Tài liệu Báo cáo khoa học: Molecular characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato pdf
... 20 03 Molecular characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato Sandra Westphal1, Daniel Kolarich 2 , Kay Foetisch1, Iris Lauer1, ... their molecular percentagesare presentec in Table 2. The peptide analysis of nLyc e 2 identified 21 peptides of the natural allergen. One of four peptides containing a potential glycosylation site ... forthe biological activity of allergens.Keywords: Lyc e 2; tomato; food allergen; IgE reactivity;glycoprotein.To date, only few attempts have been made to identify and characterize tomato allergens....
- 11
- 533
- 0
Báo cáo khoa học: Molecular characterization and gene disruption of mouse lysosomal putative serine carboxypeptidase 1 ppt
... M5535 18 kDakDa0801TH-0801THsiH -1 pepcS08 01 TH-0801THsiH -1 pepcS0801TH-080 1 THsiH-1pepcSALane 1 2 3 4 5 6 7 8 9 10 11 12 Fig. 1. Molecular forms of Scpep1. (A) Analysis of molecular ... 62 amino acids, and thus may exceed the preset mass range of the MSanalysis [29]. 13 16 17 18 19 14 15 α-Ctsaα-Ctsaα-Scpep1α-Scpep1F2 WTF2 gtBA 13 14 15 16 17 18 19 0 1 234FractionSpec. ... function of the putative lysosomal SC Scpep1,we analysed the molecular properties of Scpep1 and generated an Scpep1 gene trap (Scpep1-gt) mouse model.Results Molecular forms of Scpep1In order to generate...
- 14
- 362
- 0
Báo cáo khoa học: Molecular cloning and characterization of two soybean protein disulfide isomerases as molecular chaperones for seed storage proteins doc
... Journal compilation ê 2008 FEBS 2645 Molecular cloning and characterization of two soybean protein disulfide isomerases as molecular chaperones for seed storage proteins Shinya Kamauchi1,*,†, ... (2008) A novelplant protein disulfide isomerase family homologous toanimal P5: molecular cloning and characterization as afunctional protein for folding of soybean seed storage proteins. FEBS J ... substrate proteins. Mapping of associa-tion sites of chaperones and PDI family proteins alongindividual substrate polypeptides will be necessary for clarification of the mechanism of action of this protein family.Experimental...
- 15
- 424
- 0
Báo cáo khoa học: Molecular cloning and characterization of methylenedioxy bridge-forming enzymes involved in stylopine biosynthesis in Eschscholzia californica doc
... 1021 Molecular cloning and characterization of methylenedioxy bridge-forming enzymes involved in stylopine biosynthesis in Eschscholzia californica Nobuhiro Ikezawa1, Kinuko Iwasa2 and Fumihiko ... 38557–38565], no information is available regarding the genes for methylenedioxy bridge-forming enzymes in stylopine biosynthesis. Two cyto-chrome P450 cDNAs involved in stylopine biosynthesis were ... December2006)doi:10.1111/j.1742-4658.2007.05652.x(S) -Stylopine is an important intermediate in the biosynthesis of benzophe-nanthridine alkaloids, such as sanguinarine. Stylopine biosynthesis involvesthe sequential formation of two methylenedioxy...
- 17
- 376
- 0
Báo cáo khoa học: Molecular organization and force-generating mechanism of dynein pot
... describes our current knowledge of the molecular organization and the force-generating mechanism of dynein, with emphasison findings from electron microscopy and single-molecule nanometry.AbbreviationsBFP, ... organization and force-generating mechanism of dynein Hitoshi Sakakibara1 and Kazuhiro Oiwa1,21 National Institute of Information and Communications Technology, Kobe, Japan2 Graduate School of Life ... Sakakibara and K. Oiwa Dynein structure and its force-generating mechanism FEBS Journal 278 (2011) 29642979 ê 2011 The Authors Journal compilation ê 2011 FEBS 2969 MINIREVIEW Molecular organization and...
- 16
- 391
- 0
Báo cáo khoa học: Enzymatic characterization and molecular modeling of an evolutionarily interesting fungal b-N-acetylhexosaminidase pot
... Department of Structure and Function of Proteins, Institute of Nanobiology and Structural Biology of GCRC, Academy of Sciences of theCzech Republic and Faculty of Sciences of the University of South ... hydrolysis of N-formyl, N-glycolyl and N-propionyl derivatives of the standard N-acetylsubstrate) than A. oryzae (2–5% hydrolysis).The cloning and sequencing of PoHex and analysis of the corresponding ... carbohydrates (left panel), protein (middle panel) and for enzymatic activity (right panel). Lane 1,PoHex; lane 2, PoHex plus Endo H; lane 3, PoHex plus a-mannosidase; lane 4, Endo H; lane 5, a-mannosidase....
- 16
- 429
- 0
Báo cáo khoa học: Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation potx
... Sahin et al. (Eur. J. Biochem. 271) Ó FEBS 2004 Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation Bogachan Sahin1, Janice ... E-mail: james.bibb@utsouthwestern.eduAbbreviations: AK, adenosine kinase; Ado, adenosine; hAK, human adenosine kinase; mAK, mouse adenosine kinase. Note: Nucleotide sequence data for the long and ... kinase and 5Â- nucleotidase activity after pro-longed wakefulness in the cortex and the basal forebrain of rat.Neurochem . Int. 42, 4 49–454.Ó FEBS 2004 Recombinant mouse AK as a protein phosphorylation...
- 9
- 497
- 0
Báo cáo khoa học: Molecular characterization of secretory proteins Rv3619c and Rv3620c fromMycobacterium tuberculosisH37Rv docx
... E52I32 / V32N Rv3620c C Rv3620c N Rv3619c C Rv3619c Fig. 2. In silico modeling and docking of Rv3619c and Rv3620c. The two proteins form a 1 : 1 complex. Rv3619c is shown in blue and Rv3620c is ... heat of dilution was subtracted from the raw data of titration of Rv3619c with Rv3620c. (B) Far-UV CD spectra of Rv3619c, Rv3620c, and the 1 : 1complex. CD spectra of 5 lM Rv3619c (j), Rv3620c ... catabolism and regulation of signaling molecules [3]. Rv3618 and Rv3623 encode aprobable monooxygenase and lipoprotein, respectively. Rv3619c and Rv3620c are secretory proteins of 94 and 98 amino...
- 13
- 279
- 0
Báo cáo hóa học: " Molecular characterization and complete genome sequence of avian paramyxovirus type 4 prototype strain duck/Hong Kong/D3/75" potx
... 60 13 74 117 9 45 7 50.03P/V (P) 2 13 64 46 1182 136 34 393 42 .02P/V (V) 2 1365 46 675 644 - 2 24 23.98P/V (W) 2 1366 46 41 4 906 - 137 14. 29M 2 1293 77 1110 106 14 369 41 .45 F0 6 1891 74 1701 ... 1 of 11(page number not for citation purposes)Virology JournalOpen AccessResearch Molecular characterization and complete genome sequence of avian paramyxovirus type 4 prototype strain duck/Hong ... 15.1 24 23.3 23.6BeV 25.811.2 14. 322.923.5 24 FDLV 22.7 8.1 16.2 25 23.5 25 .4 JV 24. 2 12 .4 14. 3 24. 9 23.2 24. 1MoV 25.5 14. 216.820.811 .42 4.2MenV 34. 3 17.5 22.2 26.5 18.9 31.7TpV 24. 212 .41 4.621.218.2 24. 2*...
- 11
- 480
- 0
Báo cáo khoa học: "Molecular characterization and genogrouping of VP1 of aquatic birnavirus GC1 isolated from rockfish Sebastes schlegeli in Korea" potx
... sequence of genome segment B encoding the VP1 protein was determined for the aquatic birnavirus GC1 isolated from the rockfish Sebastes schlegeli in Korea. The VP1 protein of GC1 contains a 2,538 ... amino acid sequences. The marine aquatic birnaviruses (MABVs) containing GC1 were included in the MABV genogroup; the IPNV strains isolated from Korea, Japan, and the USA were included in ... aquatic birnaviruses containing GC1 and IPNV have genogroups that are distinct from those in the genus Avibirnaviruses and Entomo-birnaviruses. The birnavirusstrains were clustered into 5 genogroups...
- 6
- 155
- 0
Báo cáo khoa học: " Molecular characterization and phylogenetic analysis of the complete genome of a porcine sapovirus from Chinese swine" pdf
... 4760-4783SP10R CATGCCAGACCCTGATATTATCACC 5468-549211 SP11F ACCTACACCAATGTCACCTGGAC 5328-5350SP11R GTGCCACACCTACTATGACCACAG 5890-591312 SP12F TCAAGCCTCCAAACCAAGCC 5784-5803SP12R TGGCGGTCCATAAATGAGGTG ... SP8F CCTTCTACAACACCAAATGATTGCC 3768-3792SP8R AGGCCAGGATGTCAACACTGGCAC 4371-43949 SP9F ATGTATGGATAGCCCTCAGATTG 4261-4283SP9R GTCCACATCAACGGCCGCCGGCTCG 4890-491410 SP10F AGCCAACAGACACTCCTGTGTTCC ... CentralPage 1 of 10(page number not for citation purposes)Virology JournalOpen AccessResearch Molecular characterization and phylogenetic analysis of the complete genome of a porcine sapovirus...
- 10
- 401
- 0
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ