Báo cáo khoa học: "Molecular characterization and genogrouping of VP1 of aquatic birnavirus GC1 isolated from rockfish Sebastes schlegeli in Korea" potx

Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding specificity and target candidates doc

Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding specificity and target candidates doc

... great number of Arabidopsis transcripts are potential targets for regulation by the PUF family of proteins. The results obtained reveal a molecular conservation of PUF proteins in Arabidopsis thaliana and ... in Arabidopsis FEBS Journal 276 (2009) 54565470 ê 2009 The Authors Journal compilation ê 2009 FEBS 5461 Molecular characterization of Arabidopsis thali...

Ngày tải lên: 18/02/2014, 06:20

15 586 0
Tài liệu Báo cáo khoa học: Molecular cloning and characterization of soybean protein disulfide isomerase family proteins with nonclassic active center motifs pdf

Tài liệu Báo cáo khoa học: Molecular cloning and characterization of soybean protein disulfide isomerase family proteins with nonclassic active center motifs pdf

... Journal compilation ê 2009 FEBS 4135 Molecular cloning and characterization of soybean protein disulfide isomerase family proteins with nonclassic active center motifs Kensuke Iwasaki 1 , Shinya ... (2008) A novel plant protein disulfide isomerase family homologous to animal P5 – molecular cloning and characterization as a functional protein fo...

Ngày tải lên: 18/02/2014, 11:20

12 622 0
Tài liệu Báo cáo khoa học: Molecular modeling and functional characterization of the monomeric primase–polymerase domain from the Sulfolobus solfataricus plasmid pIT3 doc

Tài liệu Báo cáo khoa học: Molecular modeling and functional characterization of the monomeric primase–polymerase domain from the Sulfolobus solfataricus plasmid pIT3 doc

... with the 1–245 N-terminal domain of the putative replica- tion protein from the S. solfataricus plasmid pIT3. Furthermore, a longer variant (Rep516) comprising the 1–516 N-terminal residues of the ... tri -functional monomeric primase–polymerase domain encoded by the plasmid pIT3 from Sulfolobus solfataricus strain IT3 was identified using a structura...

Ngày tải lên: 18/02/2014, 18:20

14 620 0
Tài liệu Báo cáo khoa học: Molecular characterization, phylogenetic relationships, and developmental expression patterns of prion genes in zebrafish (Danio rerio) doc

Tài liệu Báo cáo khoa học: Molecular characterization, phylogenetic relationships, and developmental expression patterns of prion genes in zebrafish (Danio rerio) doc

... 2004 FEBS Molecular characterization, phylogenetic relationships, and developmental expression patterns of prion genes in zebrafish (Danio rerio) Emmanuelle Cotto 1,2 , Miche ` le Andre ´ 1 , ... mammalian origin by the fish intestine. Comparison of zebrafish prp1, prp2, and prp3 developmental expression patterns The developmental expression patt...

Ngày tải lên: 19/02/2014, 16:20

14 548 0
Tài liệu Báo cáo khoa học: Molecular characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato pdf

Tài liệu Báo cáo khoa học: Molecular characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato pdf

... 20 03 Molecular characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato Sandra Westphal 1 , Daniel Kolarich 2 , Kay Foetisch 1 , Iris Lauer 1 , ... their molecular percentages are presentec in Table 2. The peptide analysis of nLyc e 2 identified 21 peptides of the natural allergen. One of...

Ngày tải lên: 21/02/2014, 00:20

11 533 0
Báo cáo khoa học: Molecular characterization and gene disruption of mouse lysosomal putative serine carboxypeptidase 1 ppt

Báo cáo khoa học: Molecular characterization and gene disruption of mouse lysosomal putative serine carboxypeptidase 1 ppt

... M 55 35 18 kDa kDa 0801TH - 0801TH siH -1 p epcS 08 01 T H -0801TH s i H -1 p e p cS 0 8 0 1T H -080 1 TH siH-1pepcS A Lane 1 2 3 4 5 6 7 8 9 10 11 12 Fig. 1. Molecular forms of Scpep1. (A) Analysis of molecular ... 62 amino acids, and thus may exceed the preset mass range of the MS analysis [29]. 13 16 17 18 19 14 15 α-Ctsa α-Ctsa α-Scpep1 α-Scpep1 F2 WT F2...

Ngày tải lên: 07/03/2014, 03:20

14 362 0
Báo cáo khoa học: Molecular cloning and characterization of two soybean protein disulfide isomerases as molecular chaperones for seed storage proteins doc

Báo cáo khoa học: Molecular cloning and characterization of two soybean protein disulfide isomerases as molecular chaperones for seed storage proteins doc

... Journal compilation ê 2008 FEBS 2645 Molecular cloning and characterization of two soybean protein disulfide isomerases as molecular chaperones for seed storage proteins Shinya Kamauchi 1, * , †, ... (2008) A novel plant protein disulfide isomerase family homologous to animal P5: molecular cloning and characterization as a functional protein f...

Ngày tải lên: 07/03/2014, 05:20

15 424 0
Báo cáo khoa học: Molecular cloning and characterization of methylenedioxy bridge-forming enzymes involved in stylopine biosynthesis in Eschscholzia californica doc

Báo cáo khoa học: Molecular cloning and characterization of methylenedioxy bridge-forming enzymes involved in stylopine biosynthesis in Eschscholzia californica doc

... 1021 Molecular cloning and characterization of methylenedioxy bridge-forming enzymes involved in stylopine biosynthesis in Eschscholzia californica Nobuhiro Ikezawa 1 , Kinuko Iwasa 2 and Fumihiko ... 38557–38565], no information is available regarding the genes for methylenedioxy bridge-forming enzymes in stylopine biosynthesis. Two cyto- chrome P4...

Ngày tải lên: 07/03/2014, 10:20

17 376 0
Báo cáo khoa học: Molecular organization and force-generating mechanism of dynein pot

Báo cáo khoa học: Molecular organization and force-generating mechanism of dynein pot

... describes our current knowledge of the molecular organization and the force-generating mechanism of dynein, with emphasis on findings from electron microscopy and single-molecule nanometry. Abbreviations BFP, ... organization and force-generating mechanism of dynein Hitoshi Sakakibara 1 and Kazuhiro Oiwa 1,2 1 National Institute of Information and Communicati...

Ngày tải lên: 14/03/2014, 22:20

16 391 0
Báo cáo khoa học: Enzymatic characterization and molecular modeling of an evolutionarily interesting fungal b-N-acetylhexosaminidase pot

Báo cáo khoa học: Enzymatic characterization and molecular modeling of an evolutionarily interesting fungal b-N-acetylhexosaminidase pot

... Department of Structure and Function of Proteins, Institute of Nanobiology and Structural Biology of GCRC, Academy of Sciences of the Czech Republic and Faculty of Sciences of the University of South ... hydrolysis of N-formyl, N-glycolyl and N-propionyl derivatives of the standard N-acetyl substrate) than A. oryzae (2–5% hydrolysis). The cloning and sequencing...

Ngày tải lên: 14/03/2014, 23:20

16 429 0
Báo cáo khoa học: Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation potx

Báo cáo khoa học: Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation potx

... Sahin et al. (Eur. J. Biochem. 271) Ó FEBS 2004 Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation Bogachan Sahin 1 , Janice ... E-mail: james.bibb@utsouthwestern.edu Abbreviations: AK, adenosine kinase; Ado, adenosine; hAK, human adenosine kinase; mAK, mouse adenosine kinase. Note...

Ngày tải lên: 16/03/2014, 18:20

9 497 0
Báo cáo khoa học: Molecular characterization of secretory proteins Rv3619c and Rv3620c fromMycobacterium tuberculosisH37Rv docx

Báo cáo khoa học: Molecular characterization of secretory proteins Rv3619c and Rv3620c fromMycobacterium tuberculosisH37Rv docx

... E52 I32 / V32 N Rv3620c C Rv3620c N Rv3619c C Rv3619c Fig. 2. In silico modeling and docking of Rv3619c and Rv3620c. The two proteins form a 1 : 1 complex. Rv3619c is shown in blue and Rv3620c is ... heat of dilution was subtracted from the raw data of titration of Rv3619c with Rv3620c. (B) Far-UV CD spectra of Rv3619c, Rv3620c, and the 1 : 1 complex....

Ngày tải lên: 22/03/2014, 16:21

13 280 0
Báo cáo hóa học: " Molecular characterization and complete genome sequence of avian paramyxovirus type 4 prototype strain duck/Hong Kong/D3/75" potx

Báo cáo hóa học: " Molecular characterization and complete genome sequence of avian paramyxovirus type 4 prototype strain duck/Hong Kong/D3/75" potx

... 60 13 74 117 9 45 7 50.03 P/V (P) 2 13 64 46 1182 136 34 393 42 .02 P/V (V) 2 1365 46 675 644 - 2 24 23.98 P/V (W) 2 1366 46 41 4 906 - 137 14. 29 M 2 1293 77 1110 106 14 369 41 .45 F0 6 1891 74 1701 ... 1 of 11 (page number not for citation purposes) Virology Journal Open Access Research Molecular characterization and complete genome sequence of avian paramyxo...

Ngày tải lên: 20/06/2014, 01:20

11 481 0
Báo cáo khoa học: "Molecular characterization and genogrouping of VP1 of aquatic birnavirus GC1 isolated from rockfish Sebastes schlegeli in Korea" potx

Báo cáo khoa học: "Molecular characterization and genogrouping of VP1 of aquatic birnavirus GC1 isolated from rockfish Sebastes schlegeli in Korea" potx

... sequence of genome segment B encoding the VP1 protein was determined for the aquatic birnavirus GC1 isolated from the rockfish Sebastes schlegeli in Korea. The VP1 protein of GC1 contains a 2,538 ... amino acid sequences. The marine aquatic birnaviruses (MABVs) containing GC1 were included in the MABV genogroup; the IPNV strains isolated from Korea, Ja...

Ngày tải lên: 07/08/2014, 20:23

6 155 0
Báo cáo khoa học: " Molecular characterization and phylogenetic analysis of the complete genome of a porcine sapovirus from Chinese swine" pdf

Báo cáo khoa học: " Molecular characterization and phylogenetic analysis of the complete genome of a porcine sapovirus from Chinese swine" pdf

... 4760-4783 SP10R CATGCCAGACCCTGATATTATCACC 5468-5492 11 SP11F ACCTACACCAATGTCACCTGGAC 5328-5350 SP11R GTGCCACACCTACTATGACCACAG 5890-5913 12 SP12F TCAAGCCTCCAAACCAAGCC 5784-5803 SP12R TGGCGGTCCATAAATGAGGTG ... SP8F CCTTCTACAACACCAAATGATTGCC 3768-3792 SP8R AGGCCAGGATGTCAACACTGGCAC 4371-4394 9 SP9F ATGTATGGATAGCCCTCAGATTG 4261-4283 SP9R GTCCACATCAACGGCCGCCGGCTCG 4890-4914 10 SP10F AGCCAACAGACACTC...

Ngày tải lên: 12/08/2014, 04:21

10 401 0
Từ khóa:
w