Báo cáo khoa học: " Use of flow cytometry to develop and characterize a set of monoclonal antibodies specific for rabbit leukocyte differentiation molecules" ppsx

... housed and maintained according to the Institutional Animal Care and Use com- mittee guidelines and Association for Assessment and Accreditation of Laboratory Animal Care (USA). Both male and ... Specificity H 1A H5 8A TH14B TH8 1A5 RTH 2A RTH23 0A RTH2 1A RT2 2A MRB6 1A RTH2 6A RTH6 5A RACT5 3A RTH 1A RTH19 2A ISC1 6A ISC2 7A ISC29E ISC3 8A RT 1A RACT1 9...

Ngày tải lên: 07/08/2014, 20:23

... Binding of B. subtilis xylanase mutants with a modified secondary binding site to water-unextractable arabinoxylan (WU-AX) (A) and oat spelt xylan (OSX) (B) and of A. niger xylanase mutants to water-unextractable ... Venkataraman V, Sait HBR, Kasinathan C & Ramasubbu N (2008) Probing the role of aromatic residues at the secondary saccha- ride-binding sites of human saliv...

Ngày tải lên: 14/02/2014, 19:20

... 5¢-CAATCTCT TTGTTGGAAACCTAAACTTTCAGAAATCTGCTCCT GAATTAAAAACTGG-3¢ and 5¢-CCAGTTTTTAATTCA GGAGCAGATTTCTGAAAGTTTAGGTTTCCAACAA AGAGATTG-3¢. Mutation of Asn492 (N > A) was achie- ved with primers 5¢-GGTGAATCAAAAACTCTGGTTTT AAGCCAGCTCTCCTACAGTGCAACAGAAGAAACTC-3¢ and ... 5¢-GGTGAATCAAAAACTCTGGTTTT AAGCCAGCTCTCCTACAGTGCAACAGAAGAAACTC-3¢ and 5¢-GAGTTTCTTCTGTTGCACTGTAGGAGAGCTG GCTTAAAACCAG...

Ngày tải lên: 14/03/2014, 23:20

... gate- ways to NF-kappaB activation and transcription. Onco- gene 25, 6685–6705. 26 DiDonato JA, Hayakawa M, Rothwarf DM, Zandi E & Karin M (1997) A cytokine-responsive IkappaB kinase that ... NF-kappa B activation and complex formation with I kappa B kinase-alpha and NIK. Science 278, 866–869. 30 Rothwarf DM, Zandi E, Natoli G & Karin M (1998) IIKK-gamma is an essential regu...

Ngày tải lên: 16/03/2014, 11:20

... Netherlands). Rabbit anti-(His-tag) polyclonal antibody was used as a primary antibody and has been described before [27]. The goat anti -rabbit peroxidase (GARPO) secondary antibody was obtained ... not always guarantee optimal solubilization, stabilization and purification of GPCRs, however. To improve the performance of dodecylmaltoside, variation of ionic strength and pH...

Ngày tải lên: 30/03/2014, 14:20

... the α S1-, β-, κ-casein and the β-lactoglobulin loci of the Bavarian Brown and Bavarian Simmental cattle (1) R. GRAML, J. BUCHBERGER F. PIRCHNER Lehrstuhl ... for the FV sample, data collection was organized in such a way that at least 2 daughter-dam pairs were located at any one farm. In some cases a cow...

Ngày tải lên: 09/08/2014, 22:22

... Bulgaria, Europe. Samuelsson, C. and M. Rayner. 1991. Quantita- tive evaluation of explanation-based learning as an optimization tool for a large-scale natural lan- guage system. In IJCAI-91, ... similar problems in the future. EBL has primarily been used for parsing to automatically spe- cialize a given source grammar to a specific domain. In that case, EBL is use...

Ngày tải lên: 08/03/2014, 21:20

... 11444–11455. 12 Ozaki T, Watanabe K-I, Nakagawa T, Miyazaki K, Takahashi M & Nakagawara A (2003) Function of p73, D. O. Passos et al. Functional association of Ki-1 ⁄ 57 and PRMT1 FEBS Journal 273 (2006) ... °C for 4 h, in the presence of freshly added Adox (20 lm). Lysis, fractionation of nucleus and cyto- plasm, immunoprecipitation and SDS ⁄ PAGE were per- formed as ab...

Ngày tải lên: 16/03/2014, 13:20

... Rationale: Hau Loc is a coastal delta district, located in the north-east of Thanh Hoa Province. Its total natural land is 14.367,19 ha, of which 1.170 ha are alluvial site that to be suitable ... who are outstanding people from Woman Association and Famer Association of 6 coastal villages. They are then in charge to transfer techniques to 700 farmers who are in charge to...

Ngày tải lên: 21/06/2014, 04:20

... study, and participated in its design and coordination. AV and GMD read ECGs and measured the QTc and ana- lysed the results. CM ran the statistical analysis. AB and EC Mean QTc (bars indicate standard ... interval prolongation and torsade de pointes for a broad range of drugs: evidence for a provisional safety margin in drug development. Cardiovasc Res 2003, 58:32-45....

Ngày tải lên: 08/08/2014, 21:20