Báo cáo khoa học: "Gamma-ray irradiation stimulates the expression of caveolin-1 and GFAP in rat spinal cord: a study of immunoblot and immunohistochemistry" pot

Tài liệu Báo cáo khoa học: Oxygen tension regulates the expression of a group of procollagen hydroxylases docx

Tài liệu Báo cáo khoa học: Oxygen tension regulates the expression of a group of procollagen hydroxylases docx

... revealed a characteristic time-dependent increase of the mRNA abun- dance in A7 r5 cells incubated at 1% oxygen for P4ha1 and P4ha2, starting around 4 h of hypoxia, the induction of P4ha2 mRNA being ... as the relative mRNA/b-actin mRNA ratio. The mRNA/b-actin mRNA ratio of the time standards (pools) cDNA was set to 1.0 (i.e. normoxia, 21% oxygen). Data are therefore...

Ngày tải lên: 20/02/2014, 02:21

8 434 0
Báo cáo khoa học: Transcription termination at the mouse mitochondrial H-strand promoter distal site requires an A/T rich sequence motif and sequence specific DNA binding proteins pptx

Báo cáo khoa học: Transcription termination at the mouse mitochondrial H-strand promoter distal site requires an A/T rich sequence motif and sequence specific DNA binding proteins pptx

... the putative polyadenylation signal AATAAA, and also the sequences upstream and downstream of the canonical polyadenylation signal are important for protein binding to D-TERM DNA. The binding specificity ... however, yielded a major termination downstream of AAUAAA signal at the end of CAA*, A being the terminal nucleotide 16 295 of the mouse mt genome (189 nt tra...

Ngày tải lên: 08/03/2014, 08:20

13 415 0
Báo cáo khoa học: Thyroid hormone induces the expression of 4-1BB and activation of caspases in a thyroid hormone receptor-dependent manner pptx

Báo cáo khoa học: Thyroid hormone induces the expression of 4-1BB and activation of caspases in a thyroid hormone receptor-dependent manner pptx

... designated HeLaTR/4-1BB and HeaLaTR/ TRAF1, respectively. Primers for amplifying the 4-1BB and TRAF1 cDNAs were: 5¢-GAATTCAAGCTTATGGGA AACAGCTGTTACAACATA-3¢ and 5¢-GAATTCAAG CTTCACAGTTCACATCCTCCTTCTTCT-3¢ ... hTRa1 cDNA were: 5¢-CCCGGGAAGCTTCGGACCATGG AACAGAAGCCAAGCAAGGTG-3¢ and 5¢-CCCGGG GTCGACGACTTCCTGATCCTCAAAGACCTC-3¢ .In order to overexpress 4-1BB and TRAF1 in the HeLaTR...

Ngày tải lên: 23/03/2014, 18:20

10 491 0
Báo cáo khoa học: " Ipsilateral irradiation for well lateralized carcinomas of the oral cavity and oropharynx: results on tumor control and xerostomia" pot

Báo cáo khoa học: " Ipsilateral irradiation for well lateralized carcinomas of the oral cavity and oropharynx: results on tumor control and xerostomia" pot

... nutri- tion and speech, and accelerating dental decay [1]. Xeros- tomia is caused from bilateral irradiation of the major serous-producing glands, mainly the parotids, and the minor salivary glands ... This was likely related to the combined sparing of the contralateral parotid and part of the contralateral sub- mandibular gland. Certainly, the salivary function...

Ngày tải lên: 09/08/2014, 10:20

8 311 0
Báo cáo khoa học: "Medical treatment for the terminally ill: the ‘risk of unacceptable badness’"

Báo cáo khoa học: "Medical treatment for the terminally ill: the ‘risk of unacceptable badness’"

... to emphasize what Streat and coworkers [15] termed, the large risk of unacceptable badness’, rather than a vanishingly small potential for benefit. There are far worse things than death, and many of ... unsuccessful in achieving a stated goal. Therefore, if a patient in a progressive, inevitable death spiral is placed on mechanical ventilation, it is not technically futil...

Ngày tải lên: 25/10/2012, 10:45

2 463 0
Tài liệu Báo cáo khoa học: Dmrt1 genes at the crossroads: a widespread and central class of sexual development factors in fish pdf

Tài liệu Báo cáo khoa học: Dmrt1 genes at the crossroads: a widespread and central class of sexual development factors in fish pdf

... Y, Sakai F & Nagahama Y (2010) Doublesex- and Mab-3-related transcription factor-1 repression of aromatase transcription, a possible mechanism favoring the male pathway in tilapia. Endocrinology ... males, abundant dmrt1 expression during preparatory and prespawning and spermatogenesis periods was seen, in contrast to a gradual decrease thereafter during spawning ⁄ spe...

Ngày tải lên: 14/02/2014, 19:20

10 861 0
Tài liệu Báo cáo khoa học: Nucleolin/C23 mediates the antiapoptotic effect of heat shock protein 70 during oxidative stress pptx

Tài liệu Báo cáo khoa học: Nucleolin/C23 mediates the antiapoptotic effect of heat shock protein 70 during oxidative stress pptx

... Institutional Animal Care and Use Committee of the Center South Uni- versity, and were carried out in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. All ... min. After centrifugation (10 000 g, 1 min, 4 °C), the protein concentration in the supernatant was determined using the BioRad protein assay. Supernatants c...

Ngày tải lên: 16/02/2014, 09:20

11 615 0
Tài liệu Báo cáo khoa học : Các phương thức thể hiện lời nói trên đài phát thanh docx

Tài liệu Báo cáo khoa học : Các phương thức thể hiện lời nói trên đài phát thanh docx

... thdc nay la phdng vien, bien tap vien ed uy tin, cd kinh nghiem eua Dai. Mdt .sd nha bao trong Diin din Kinh te, Diin din Khoa hpc va Cdng nghi. Bin trdn im nhac, Diin dan Giio due da ... trade ma phai bat ra tu hien thyc sinh ddng, Ngudi ndi phai xu ly cung mdt ldc rat nhidu cdng viee: vua quan sat hinh anh thu dugc td camera, quan sat mdn hinh bien tap, ket ndi dien t...

Ngày tải lên: 17/02/2014, 05:20

6 742 1
Tài liệu Báo cáo khoa học: MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor pdf

Tài liệu Báo cáo khoa học: MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor pdf

... 5′3′ CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA ACAAUGUGAAA GCAAUGUGAUA 5′ 3′ UAAAUGUGAAU ACUAAGAGUAA GCAAUGUGAUA IL6R mRNA mut 1 5′ 3′ UAAAUGUGAAU ACAAUGUGAAA GCUAAGAGUUA IL6R ... 5′3′ 3′ UAUAAGAGUAU CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA 3′ 5′ 3′ 5′ 5′3′ CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA 3′ 5′ 3′...

Ngày tải lên: 18/02/2014, 04:20

9 541 0
Từ khóa:
w