Báo cáo khoa học: "Characterization of HC58cDNA, a putative cysteine protease from the parasite Haemonchus contortus" pps
Báo cáo khoa học: Characterization of scorpion a-like toxin group using two new toxins from the scorpion Leiurus quinquestriatus hebraeus doc
... alain.hamon@univ-angers.frAbbreviations: Aah2, alpha toxin II from the venom of the scorpionAndroctonus australis hector, also called AaH; ATX II, toxin II of the sea anemone Anemonia sulcata; Bom3,4, a- like toxins from ... mass of Lqh6 and the calculated molecular mass indicates amidation of the C-terminal amino acid residue. The absence of a free a- carboxyl group was confirmed by the failure of carboxy-peptidase ... compared tothose of Aah2, a classical a- toxin [30]. Addition of Aah2 to the bath medium at a saturating concentration (0.1 lM)induced a progressive slowing of the inactivation kinetics of Na...
- 14
- 380
- 0
Báo cáo khoa học: Characterization of eIF3k A newly discovered subunit of mammalian translation initiation factor eIF3 potx
... instructions (Amersham Pharmacia). The amount of cell lysate incubated with the beads was adjustedso that a similar amount of each subunit was bound to the beads. The beads were washed once and then ... Identification of cDNA clones for the large subunit of eukaryotic translation initiation factor 3. Comparison of homologues from human, Nicotiana tabacum, Caenorhabditiselegans and Saccharomyces ... University of California, Davis, CA, USAMammalian translation initiation factor 3 (eIF3) is a multisubunit complex containing at least 12 subunits with anapparent aggregate mass of 700 kDa. eIF3...
- 7
- 256
- 0
Tài liệu Báo cáo khoa học: Characterization of phycoviolobilin phycoerythrocyanin-a84-cysteinlyase-(isomerizing) from Mastigocladus laminosus pdf
... Kishida, Y., Kohara, M., Matsumoto, M., Matsuno, A. , Muraki, A. , Nakazaki, N., Siumpo, S., Sugimoto, M., Taka-zawa,M.,Yamada,M.,Yasuda,M.&Tabata,S.(2001)Com-plete genomic sequence of the filamentous ... basis of the highly reversiblephotochemistry of a- PEC and the protein dynamics relatedto the transformation, the other is to evaluate the potential of the relatively small chromoprotein as a photo ... His6-PecA was decreased 15%. However, in thiscase a small amount of the ligation/isomerization product,His6 -a- PECA, was formed (7% as compared to the maximal yield of His6 -a- PecA in the presence...
- 9
- 468
- 0
Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc
... isolated previously[22] using the following primers: gatggatcccatATGGGTGTTGAAGTTGTA annealing around the start codon of the Ppi1 ORF and gactcgagATTAGTCGACTTCTTACGCannealing just before the putative ... with antisera against the N-terminus of PPI1 (A) or the C-terminus of the H+-ATPase (B).His6–ACA8(1–116) reproduces the N-terminus of an A. thaliana PMCa2+-ATPase [31]. Results are from ... plasma membranereceptor and the activation of the plasma membraneH+-ATPase. IV. Fusicoccin induces the associationbetween the plasma membrane H+-ATPase and the fusicoccin receptor. Plant...
- 8
- 629
- 0
Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt
... 5¢-TTGATCGATTCTGTCTATGCCCCA-3¢ along with the adaptor primers: AP1 (5¢-GTAATACGACTCACTATAGGGC-3¢) and AP2 (5¢-ACTATAGGGCACGCGTGGT-3¢).Nested PCR was carried out in a final volume of 50 lLcontaining 1 lL of a genome ... 5¢-GATGAAAATCCTAACCTCTCCCCCGCACAG-3¢; OP7, 5¢-ACTGCACCTACGGCGGGTCGTTGGTACGTG-3¢; NP4, 5¢-GACACCGTAGGTTGAGCCGCCAATCGTCCC-3¢; NP5, 5¢-CTTTAACTTGTTGGGCACTGGCATTG-3¢; NP6, 5¢-TTGATCGATTCTGTCTATGCCCCA-3¢ ... PCR was performed in 50 lL containing 1 ng of genomic DNA as template, 0.2 mm dATP, dCTP, dGTPand dTTP, 0.2 lm of upstream primer (OP17: 5¢-GAAAAACCATGGTGAATGAATACCAAGCGACT-3¢ ) anddownstream...
- 14
- 523
- 0
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx
... pGL3e:Prm 3a AP)1*,pGL3b:Prm3abAP)1*, pGL3e: Prm3abAP)1*, pGL3b:Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL3b:Prm3aaaAP)1*and pGL3e:Prm3aaaAP)1*.Mutation of the Oct-1 element with the sequence aaATGCa to aaTTCCa ... to aaTTCCa (core bases shown in uppercase letters)centered at )123 within Prm3 was performed using the mutator primers Kin175 (5¢-CACCAGAGCTACTTACACTGAATTCCAGAATAATCACAAGCAAATC-3¢; senseprimer) ... Witte DP & Grabowski GA (1998) Isola-tion and characterization of the human prosaposin pro-moter. Gene 218, 37–47.51 de Grazia U, Felli MP, Vacca A, Farina AR, Maroder M,Cappabianca L, Meco...
- 18
- 509
- 0
Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf
... nativesignal peptide was amplified by PCR using the followingprimers: 5¢ primer, 5¢-GAGCCCGGATCCACCATGAAGGTCTCAATAATT 3¢;3¢ primer, 5¢-CTGACG GAATTCTTAAACATTAATGCC 3¢. These primers encoded a Kozak ... W81, as observed with M. brassicae CSPMbraA6[32]. We observed also that BrC15-Ac was able to displaceASA, suggesting that brominated fatty acid and ASA bothassociated with W81 in the same ligand ... melanogasterejaculatory bulb [30], Mamestra brassicae proboscis [17],labial palps of the moth Cactoblastis cactorum [14] and cellsunderlying the cuticle in Phasmatodea and Orthoptera [31].Although...
- 11
- 642
- 0
Báo cáo khoa học: Characterization of a thiamin diphosphate-dependent phenylpyruvate decarboxylase from Saccharomyces cerevisiae potx
... the Bradford assay using BSA as standard.Assay The decarboxylation activity of ScPPDC-His on a range of aromatic and aliphatic 2-keto acids was monitored at 30 °Cby a coupled assay described ... A com-parison of these and the parameters of the wild-typeenzyme are presented in Table 3.ScPPDC-E545L was unstable in the buffer used for the IPyA assay and thus was assayed in the standardbuffer ... show allosteric activation? Again, the answer maylie with AbPPDC. It has been proposed that, ratherthan the typical Glu-Asp-His motif, AbPPDC has anAsp-Asp-His catalytic triad in which Asp282...
- 12
- 436
- 0
Báo cáo khoa học: Characterization of the rice carotenoid cleavage dioxygenase 1 reveals a novel route for geranial biosynthesis ppt
... member of the CCD1 subfamily was identified from Arabidopsisthaliana [26], and was later shown to act as a dioxygenase [27]. Sequence homology then allowed the identification and charcterization of ... low amount of the C14dialde-hyde is probably a result of instability. The formation of b-ionone from b-apo-8¢-carotenal (C30) and b-apo-10¢-carotenal (C27) suggested that the cleavage of ... to extraction. The conversion rates weredetermined by calculating the decrease of substrate peakareas measured at their individual kmaxvalues using the max plot function of the software empower...
- 12
- 497
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDENghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ