Báo cáo khoa học: "Neuropharmacological effects of deltamethrin in rats" pot

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... The Authors Journal compilation ê 2009 FEBS Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary ... Restriction site W11F WT W11F CA CCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoI W168F WT W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI WT* W11F W11F ⁄ W168F...

Ngày tải lên: 18/02/2014, 11:20

15 635 0
Tài liệu Báo cáo khoa học: Antimicrobial effects of H4-(86–100), histogranin and related compounds – possible involvement of DNA gyrase ppt

Tài liệu Báo cáo khoa học: Antimicrobial effects of H4-(86–100), histogranin and related compounds – possible involvement of DNA gyrase ppt

... the involvement of DNA gyrase in the antimicrobial effects of H4-(8 6–1 00) and related compounds was obtained in vitro by the mea- surement of their inhibitory activity on the supercoiling of pBR322 ... those of the inactive antimicrobial fragments HNb-( 1–1 3) and HNb-( 3–1 3) (Table 2) were not signifi- cant (Fig. 6B). The antimicrobial and anti -DNA...

Ngày tải lên: 18/02/2014, 14:20

12 756 0
Tài liệu Báo cáo khoa học: Differential effects of Mxi1-SRa and Mxi1-SRb in Myc antagonism ppt

Tài liệu Báo cáo khoa học: Differential effects of Mxi1-SRa and Mxi1-SRb in Myc antagonism ppt

... predominant transcript in the adult intestine and in the developing embryo, whereas Mxi1-SRb transcripts predominate in the adult liver and kidney [12]. In our initial description of Mxi1-SRa and ... arising in the REF assay. E1 is from a Myc + Ras + empty vector point, a1 and a2 are from Myc+ Ras+ Mxi1-SRa points, and b1 and b2 are from Myc+ Ras+ Mxi1-SRb...

Ngày tải lên: 18/02/2014, 16:20

11 587 0
Tài liệu Báo cáo khoa học: Inhibitory effects of nontoxic protein volvatoxin A1 on pore-forming cardiotoxic protein volvatoxin A2 by interaction with amphipathic a-helix doc

Tài liệu Báo cáo khoa học: Inhibitory effects of nontoxic protein volvatoxin A1 on pore-forming cardiotoxic protein volvatoxin A2 by interaction with amphipathic a-helix doc

... Journal compilation ê 2006 FEBS 3167 Inhibitory effects of nontoxic protein volvatoxin A1 on pore-forming cardiotoxic protein volvatoxin A2 by interaction with amphipathic a-helix Pei-Tzu Wu 1 , ... VVA2 can use VVA1 as a basis for the formation of VVA2 oligomers. Interaction of VVA1 and VVA2 by amphipathic a-helix To identify the binding sites...

Ngày tải lên: 19/02/2014, 06:20

12 585 0
Tài liệu Báo cáo khoa học: Functional effects of deleting the coiled-coil motif in Escherichia coli elongation factor Ts pptx

Tài liệu Báo cáo khoa học: Functional effects of deleting the coiled-coil motif in Escherichia coli elongation factor Ts pptx

... investigated by studying the functional effects of deleting the motif in EF -Ts, both in vivo and in vitro. The motif was deleted in endogenous EF -Ts in E. coli strain UY211 by gene replacement, and the phenotype ... reduced. Stability of the EF-Tu–EF -Ts complex in the presence of kirromycin The growth of GRd.tsf in the presence of kirro...

Ngày tải lên: 21/02/2014, 00:20

12 502 0
Báo cáo khoa học: Differential effects of RU486 reveal distinct mechanisms for glucocorticoid repression of prostaglandin E2 release docx

Báo cáo khoa học: Differential effects of RU486 reveal distinct mechanisms for glucocorticoid repression of prostaglandin E2 release docx

... Differential effects of RU486 reveal distinct mechanisms for glucocorticoid repression of prostaglandin E 2 release Joanna E. Chivers 1 , Lisa M. Cambridge 1 , ... and RU486 (< 1 l M ) was without significant effect. Thus, two pharmacologically distinct mechanisms of glucocorticoid- dependent repression of prostaglandin E 2 release are revealed. Fir...

Ngày tải lên: 07/03/2014, 16:20

11 527 0
Báo cáo khoa học: Modulatory effects of plant phenols on human multidrug-resistance proteins 1, 4 and 5 (ABCC1, 4 and 5) potx

Báo cáo khoa học: Modulatory effects of plant phenols on human multidrug-resistance proteins 1, 4 and 5 (ABCC1, 4 and 5) potx

... MOAT-C and MRP5), a member of the ABC family of proteins, has anion C P. Wu et al. Plant polyphenols modulate MRP1, 4 and 5 FEBS Journal 272 (20 05) 47 25 47 40 ª 20 05 FEBS 47 39 resveratrol, MK -57 1 and ... Modulatory effects of plant phenols on human multidrug-resistance proteins 1, 4 and 5 (ABCC1, 4 and 5) Chung-Pu Wu 1,2 , Ann...

Ngày tải lên: 07/03/2014, 21:20

16 517 0
Báo cáo khoa học: The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 pot

Báo cáo khoa học: The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 pot

... compilation ª 2009 FEBS The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 Christian Freese 1, *, Alistair N. Garratt 2 , Falk Fahrenholz 1 and Kristina Endres 1 1 Institute of Biochemistry, ... interact. Reconstitution experiments with transfection of ADAM10 in ADAM17) ⁄ ) embryonic mouse fibro- blasts [55] suggested only a minor influence of ADA...

Ngày tải lên: 16/03/2014, 04:20

13 488 0
Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx

Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx

... 2005 FEBS 6115 Mutual < /b> effects < /b> of < /b> proton < /b> and < /b> sodium < /b> chloride < /b> on < /b> oxygenation < /b> of < /b> liganded < /b> human < /b> hemoglobin < /b> Oxygen < /b> affinities < /b> of < /b> the < /b> a < /b> and < /b> b subunits Sergei V. Lepeshkevich and < /b> Boris M. Dzhagarov Institute ... (3) and < /b> (4), the < /b> dissociation r...

Ngày tải lên: 16/03/2014, 14:20

11 577 0
Báo cáo khoa học: Multiple effects of DiS-C3(5) on mitochondrial structure and function pot

Báo cáo khoa học: Multiple effects of DiS-C3(5) on mitochondrial structure and function pot

... c remain to be conducted. In conclusion, we found DiS-C 3 (5) to show multiple effects on the mitochondrial structure and function, effects dependent on both its concentration and the P i status. 11 Acknowledgements This ... FEBS 2004 Effects of DiS-C on mitochondrial structure and function (Eur. J. Biochem. 271) 3577 Multiple effects of DiS-C 3 (5) on...

Ngày tải lên: 16/03/2014, 18:20

7 481 0
Báo cáo khoa học: Differential effects of histone deacetylase inhibitors on phorbol ester- and TGF-b1 induced murine tissue inhibitor of metalloproteinases-1 gene expression docx

Báo cáo khoa học: Differential effects of histone deacetylase inhibitors on phorbol ester- and TGF-b1 induced murine tissue inhibitor of metalloproteinases-1 gene expression docx

... on basal expression of Timp-1, only on induced gene expression. In conclusion, this is to our knowledge, the only described instance of HDAC inhibitors having oppos- ite effects on the same gene, ... action of HDACi could therefore be either on the Timp-1 gene itself, or on the expression of a protein(s) required for induction of the Timp-1 gene. Time co...

Ngày tải lên: 16/03/2014, 18:20

15 347 0
Báo cáo khoa học: "THE INTERPRETATION OF TENSE IN DISCOURSE" potx

Báo cáo khoa học: "THE INTERPRETATION OF TENSE IN DISCOURSE" potx

... by TF is the beginning of the interval. What in turn sites the RT of the main clause is the end of the interval. The processing of the first two clauses is just the same as in examples 7a and ... diverge. In 10a-3, the beginning of ADV is most plausibly interpreted with respect to the TF. The end of ADV in turn provides an anaphoric interpretation point for RT 3....

Ngày tải lên: 17/03/2014, 20:20

8 338 0
Báo cáo khoa học: "Psychoimmunological effects of dioscorea in ovariectomized rats: role of anxiety level" pps

Báo cáo khoa học: "Psychoimmunological effects of dioscorea in ovariectomized rats: role of anxiety level" pps

... protein. Effects of chronic administration of dioscorea on immobility in the forced swim testFigure 1 Effects of chronic administration of dioscorea on immobility in the forced swim test. Dioscorea ... provide a new insight into the pathophysiological role of IL-2 in postmenopausal anxiety. IL-2 could be involved in the mechanisms underlying the behavioral eff...

Ngày tải lên: 08/08/2014, 23:20

8 232 0
Báo cáo khoa học: "Beneficial effects of erythropoietin in preclinical models of shock and organ failure" ppsx

Báo cáo khoa học: "Beneficial effects of erythropoietin in preclinical models of shock and organ failure" ppsx

... beneficial effects of EPO in preclinical models of shock, trauma and haemorrhage are exciting, but further studies are warranted to determine the effects of EPO on outcome (organ injury/dysfunction and ... antioxidant and anti-inflammatory effects of EPO, which have been reported in other models of disease [11]. Thus, the beneficial effects of EPO in ro...

Ngày tải lên: 13/08/2014, 03:21

2 174 0
w