Báo cáo khoa học: "Epitheliotropic cutaneous lymphoma (mycosis fungoides)in a dog" pps

... which suggests that PhyH-DI has the capacity to increase the catalytic efficiency of PhyH-DII. Further- more, the catalytic efficiency of PhyH was much greater than that of PhyH-DI and PhyH-DII combined ... was basically stable at 35 °C, and retained 60% of the initial activity at 45 °C for 90 min when assayed at 35 °C (Fig. 3A, B). The presence of Ca 2+ increas...

Ngày tải lên: 14/02/2014, 15:20

... M, Shibata Y, Sakai F & Nagahama Y (2010) Doublesex- and Mab-3-related transcription factor-1 repression of aromatase transcription, a possible mechanism favoring the male pathway in tilapia. ... MINIREVIEW Dmrt1 genes at the crossroads: a widespread and central class of sexual development factors in fish Amaury Herpin and Manfred Schartl Physi...

Ngày tải lên: 14/02/2014, 19:20

... Journal 277 (2010) 4909–4919 ª 2010 The Authors Journal compilation ª 2010 FEBS 4913 Proteomic analysis of dopamine and a- synuclein interplay in a cellular model of Parkinson’s disease pathogenesis Tiziana ... alterations associated with the interplay of cytosolic dopamine and increased a- synuc- lein are still unclear. Catecholaminergic SH-SY5Y human...

Ngày tải lên: 15/02/2014, 01:20

... 13 2–1 40. 32 Mori K, Hieda N, Yamanishi M, Shibata N & Toraya T (2005) Crystallization and preliminary X-ray analysis of molecular chaperone-like diol dehydratase- reactivating factor in ADP-bound ... reactivat- ing factors – that is, subunit swapping might occur. However, no biochemical evidence for this has been obtained so far. A similar reactivating factor...

Ngày tải lên: 15/02/2014, 01:20

... related by a dyad axis in the crystal, and a mixture of monomeric and dimeric forms in solution [18]. Therefore, the available structural data suggest that the minimal functional unit in the ACMSD enzyme ... respectively. The major interactions established between the DHAP inhibitor and the protein milieu are indicated by dotted lines. Crystal structure...

Ngày tải lên: 18/02/2014, 06:20

... Y. Cai et al. 3584 FEBS Journal 276 (2009) 35753588 ê 2009 The Authors Journal compilation ê 2009 FEBS Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 Yuanheng ... subunit molecular mass was also estimated by SDS–PAGE. Characterization and comparative analyses of HYD Js and HYD Bp The optimal temperature for activi...

Ngày tải lên: 18/02/2014, 08:20

... activates adenylate cyclase (CyaA) and leads to an increase in the intra- cellular cyclic AMP (cAMP) level [1]. Mathematical models of catabolite repression in E. coli The (isolated) reactions of the ... key players of catabolite repression. Mathematical modelling of signal transduction and gene expres- sion of the enzymes involved in the transport of carbohydrate...

Ngày tải lên: 18/02/2014, 13:20

... ouabain, a natural blocker of the Na + pump and an inhibitor of palytoxin action, have pro- vided interesting findings. Through the partial inhibition of Na + ⁄ K + -ATPase, and regardless of ... Louzao, Isabel R. Ares and Eva Cagide Departamento de Farmacologia, Facultad de Veterinaria, Universidad de Santiago de Compostela, Lugo, Spain Introduction Palytoxin is a po...

Ngày tải lên: 18/02/2014, 14:20

... 5859 Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium A. Pappachan 1 , H. S. Savithri 2 and M. R. N. Murthy 1 1 Molecular ... (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG TGCCAACTCCCAC) containing a BamHI site. The gene...

Ngày tải lên: 18/02/2014, 14:20

...

Ngày tải lên: 07/08/2014, 18:21

...

Ngày tải lên: 07/08/2014, 18:21

... purposes) World Journal of Surgical Oncology Open Access Case report Mantle cell lymphoma of the gastrointestinal tract presenting with multiple intussusceptions – case report and review of literature Venkata ... D1. Few cases of mantle cell lymphoma presenting with intussuception have been reported. Here we present a rare case of multipl...

Ngày tải lên: 09/08/2014, 04:21

... English lan- guage published articles, there are only 10 reported cases of pleural Mesothelioma with distant subcutaneous metastases [8,10-17]; seven of them had metastases to the face and/ or scalp. ... small number of cases of subcutaneous metastases of malignant Mesothelioma has been reported. However, the majority of the reported cases were considered as l...

Ngày tải lên: 09/08/2014, 04:21

... Takimoto T, Nakata S, Shiga J, Nagate Y, Nakagawa T, Take H, Katagiri S: Intravascular large B-cell lymphoma presenting pulmonary arterial hypertension as an initial manifestation. Intern Med 2010, ... Ota K, Katayama N, Tsuda T, Yukawa S: A case of pulmonary intravascular lymphomatosis diagnosed by thoracoscopic lung biopsy. Respiration 2003, 70:414-418. 8. Kitanaka A, Kubo...

Ngày tải lên: 10/08/2014, 23:21

... angiosarcoma: Idiopathic angiosarcoma of the head and neck in elderly patients, lymphoedema-associated angiosarcoma (Stew- art-Treves-Syndrome) and postirradiation angiosarcoma [2]. Besides an association ... ulceration and bleeding, mimicking other malignancies like squa- mous cell carcinoma, basal cell carcinoma, malignant melanoma, lymphoma as well as metastases [3,5,8]. Microscopi...

Ngày tải lên: 11/08/2014, 20:20