Báo cáo khoa học: "Histology of two rice bodies isolated from the stifle of an adult draught horse stallion" pps
Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx
... nonribosomal peptide synthetases: the emerging view from bacterial genomics. Nat Prod Rep24, 107 3–1 109.32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H,Naganawa H, Hamada M & Takeuchi T (1985) ... on an analytical scale. The sensitivity of radioactivity detection and sophisti-cated analytical separation proved to be advantageousin this approach. The iron-chelating properties of the A BFig. ... 2009 The Authors Journal compilation ê 2009 FEBS 667 Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea Lars Robbel, Thomas A. Knappe, Uwe...
- 14
- 614
- 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... CP-pyk(5Â-ACGACTAGTGGATCCATNNNNNAGTTTATTCTTGACANNNNNNNNNNNNNNTGRTATAATNNNNAAGTAATAAAATATTCGGAGGAATTTTGAAATGAATAAACGTGTAAAAATCG-3Â)(Nẳ A, T, G, C) and pyk-back (5Â-CTCTACATGCATTTCAACAATAGGGCCTGTC-3Â) ... enzymes: Jl a las ịẳ0:0123 93:9 a las ị1 e7: 1a 3:2 las ị0:276, Jglucose a las ịẳ0:693 83:3 a las ị1 e 6a 2:1 las ị33:2 (User dened),Jlactate a las ịẳ0:919 129 a las ị1 e 6a 2:1 las ị75:2 ... FEBS 2295 Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis Brian Koebmann, Christian Solem and Peter Ruhdal JensenMicrobial Physiology and Genetics,...
- 12
- 616
- 0
Tài liệu Báo cáo khoa học: Long-distance interactions between enhancers and promoters The case of the Abd-B domain of the Drosophila bithorax complex pdf
... Sipos and H. Gyurkovics Long-distance interactions in Abd-B REVIEW ARTICLE Long-distance interactions between enhancers and promoters The case of the Abd-B domain of the Drosophila bithorax complex La´szlo´Sipos ... regulation of the homeoticAbdominal-B (Abd-B) gene in Drosophila. Abd-B, one of the three genes in the bithorax complex (BX-C), determines the identity of the posterior-mostsegments in the fly. One Abd-B ... later than in the case of the histone gene cluster [10]. This difference in the tim-ing of somatic pairing perhaps reflects the difference between the complexities of the regulation of the twosystems:...
- 7
- 719
- 0
Tài liệu Báo cáo khoa học: "NATURAL LANGUAGE AND COMPUTER INTEBFACE DESIGN MURRAY TUROFF DEPARTMENT OF COMPUTER AND IiVFORMATION SCIENCE IIEW JERSEY INSTITUTE OF TECHNOLOGY" ppt
... NATURAL LANGUAGE AND COMPUTER INTEBFACE DESIGN MURRAY TUROFF DEPARTMENT OF COMPU%'z~ AND IiVFORMATION SCIENCE IIEW JERSEY INSTITUTE OF TECHNOLOGY SOME ICONOCLASTIC ... first impression of what a computer is like. COMPUTERIZED CONFERENCING Since 1973 at the New Jersey Institute of Technology, we have been developing and evaluating the use of a computer as a ... idea is to use the processing and logical capabilities of the computer to aid in the communication and exchange of written text (Hiltz & Turoff, 1978). As part of this program we have been...
- 2
- 465
- 0
Báo cáo khoa học: Cyclic ADP-ribose requires CD38 to regulate the release of ATP in visceral smooth muscle ppt
... preparation. Of particular importance is the finding that exogenous cADPR failed to increase the spontaneous release of ATP in the absence of CD38. In other words, the presence of CD38 is mandatoryfor the ... enhanced the spontane-ous release of ATP but not the release of ATP evokedby action potential firings. The enhancing effect of cADPR on spontaneous release of ATP was: (a) unaf-fected by inhibition ... of ATP. Further studies are needed to determine the mechanisms of purine-mediated presynaptic neuromod-ulation in the bladder. The enhancing effect of cADPR on the spontaneous release of ATP...
- 14
- 509
- 0
Báo cáo khoa học: Nuclear actin and actin-binding proteins in the regulation of transcription and gene expression docx
... muscles and several cancer cell lines [94].Table 1. Role of nuclear actin- binding proteins interacting with the androgen receptor. AR, androgen receptor; LBD, ligand-binding domain. Actin- bindingproteinTargetingsequence ... ARTICLE Nuclear actin and actin- binding proteins in the regulation of transcription and gene expression Bin Zheng1, Mei Han1, Michel Bernier2 and Jin-kun Wen11 Department of Biochemistry and ... members of the actin- bindingLIM protein (ABLIM) family, ABLIM-2 and -3, asSTARS-interacting proteins. These novel proteins con-tain four LIM domains and a C-terminal villin head-piece domain,...
- 17
- 573
- 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc
... (Paris,France): 5forGulox (forward), 5Â-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGATGACGACGACAAGATGAGCCCGATATGGAGTAATTGGCCT-3Â; and 3rev-Gulox (reverse), 5Â-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT A- 3Â. ... Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase Beata A. Wolucka1and David Communi21 Laboratory of Mycobacterial Biochemistry, ... (l-ascorbic acid; L-AA) is an importantmetabolite of plants and animals. It functions as anantioxidant (or pro-oxidant), an enzyme cofactor, aneffector of gene expression, and a modulator of react-ive...
- 11
- 571
- 0
Báo cáo khoa học: Nautilin-63, a novel acidic glycoprotein from the shell nacre of Nautilus macromphalus doc
... 2011 The Authors Journal compilation ª 2011 FEBS Nautilin-63, a novel acidic glycoprotein from the shell nacre of Nautilus macromphalus Benjamin Marie1,2, Isabelle Zanella-Cle´on3, Marion ... CaCO3precipitation. First, the effect of the nacre matrix started to occur above 1 lg of the ASM and the delay of the reaction was dose-dependent. At approximately 50 lg of nacre ASM, a complete ... most of them correspond to proteins of the pearl oyster or the abalone models. None of them were described from the cephalopod nacre. Although the Nautilus nacre has already been the focus of several...
- 14
- 383
- 0
Báo cáo khoa học: Novel c-carboxyglutamic acid-containing peptides from the venom of Conus textile docx
... the mechanistic properties of an ancestralcarboxylation system.Here, we describe the purification and characteriza-tion of four novel Gla-containing conotoxins from C. textile. All of the peptides ... to )1). The propeptide regions of the conotoxins reported here share structural and physico-chemical properties with the pro- and postpeptides of other Gla-containing peptides from Conus spp.(Table ... ionmass spectrum of the doubly charged ion at m z ẳ660.18. The isotopic distribution of the b2ion (inset)indicates the presence of bromine. The MS ⁄ MSspectrum allows assignment of the sequenceSW*NCYNGHCTG,...
- 10
- 437
- 0
Báo cáo khoa học: A new highly toxic protein isolated from the death cap Amanita phalloides is an L-amino acid oxidase pdf
... protein isolated from the death cap Amanita phalloides is an L-amino acid oxidase Taras Stasyk1,2, Maxim Lutsik-Kordovsky1, Christer Wernstedt3, Volodymyr Antonyuk1,Olga Klyuchivska1, ... pro-tein from death cap Amanita phalloides: isolation andstudy of cytotoxic activity. Studia Biologica 2, 21–32.17 Martin F, Aerts A, Ahre´n D, Brun A, Danchin EG,Coutinho PM, Henrissat B, Tuskan ... in the organism.In conclusion, in the present study, a novel cytotoxic protein was isolated from the death cap and character-ized. The physico-chemical, chemical and biologicalcharacteristics...
- 10
- 473
- 0
Báo cáo khoa học: A Kazal prolyl endopeptidase inhibitor isolated from the skin of Phyllomedusa sauvagii pdf
... twovariants of a new protein isolated from the skin of the anuran, P. sauvagii, whose sequence indicates membership of the Kazal family. Most members of this family are smallprotein inhibitors of ... acrosin – the major protease of mammalianspermatozoa – from the crab-eating monkey, Macacafascicularis (Table 1).Whereas many Kazal inhibitors have proline at P2, onlytwowerereportedtohaveprolineatP1[43,44]. ... theirmembranes.Materials and methodsMaterialsAll chemicals were of the purest analytical grade available.Proteases, aprotinin, lysozyme, and a- casein were from Sigma-Aldrich. Z-Arg-pNA (N-benzyloxycarbonyl-arginyl-p-nitroanilide)...
- 10
- 456
- 0
Báo cáo khoa học: "Radial variations in wood mineral element concentrations: a comparison of beech and pedunculate oak from the Belgian Ardennes" pps
... Original articleRadial variations in wood mineral element concentrations: a comparison of beech and pedunculate oak from the Belgian ArdennesValérie Penninckx, Suzanne Glineur, Wolf ... Comparison of oak and beech There are striking differences in mineral element con-centration profiles in the wood of oak and beech growingat the same site. In hardwoods, Taneda et al. [29] cate-gorised ... patterns in mineral element concentrations in Pedunculate oak (Quercusrobur L.) and European beech (Fagus sylvatica L.)growing at the same site. Beech and oak are dominanttrees in several forest...
- 8
- 230
- 0
báo cáo khoa học: "Hepatocyte growth factor incorporated chitosan nanoparticles augment the differentiation of stem cell into hepatocytes for the recovery of liver cirrhosis in mice" pptx
... al.: Hepatocyte growth factor incorporated chitosan nanoparticles augment the differentiation of stem cell into hepatocytes for the recovery of liver cirrhosis in mice.Journal of Nanobiotechnology ... Open AccessHepatocyte growth factor incorporated chitosan nanoparticles augment the differentiation of stem cell into hepatocytes for the recovery of liver cirrhosis in miceSivasami Pulavendran1, ... levels of growth factors in the niche of injured microenvironment neces sitates the exogenous and sustainable delivery of growth factors along with stem cells to augment the regeneration of injured...
- 11
- 404
- 0
Từ khóa: Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Chuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ