Báo cáo khoa học: "Histology of two rice bodies isolated from the stifle of an adult draught horse stallion" pps

Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx

Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx

... nonribosomal peptide synthetases: the emerging view from bacterial genomics. Nat Prod Rep 24, 107 3–1 109. 32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H, Naganawa H, Hamada M & Takeuchi T (1985) ... on an analytical scale. The sensitivity of radioactivity detection and sophisti- cated analytical separation proved to be advantageous in this approach. The iron-chelating pro...

Ngày tải lên: 16/02/2014, 09:20

14 614 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

... CP-pyk (5Â-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3Â)(Nẳ A, T, G, C) and pyk- back (5Â-CTCTACATGCATTTCAACAATAGGGCCTG TC-3Â) ... enzymes: J l a las ịẳ 0:0123 93:9 a las ị1 e 7: 1a 3:2 las ị0:276, J glucose a las ịẳ 0:693 83:3 a las ị1 e 6a 2:1 las ị33:2 (User dened), J lactate a las ịẳ0...

Ngày tải lên: 19/02/2014, 17:20

12 616 0
Tài liệu Báo cáo khoa học: Long-distance interactions between enhancers and promoters The case of the Abd-B domain of the Drosophila bithorax complex pdf

Tài liệu Báo cáo khoa học: Long-distance interactions between enhancers and promoters The case of the Abd-B domain of the Drosophila bithorax complex pdf

... Sipos and H. Gyurkovics Long-distance interactions in Abd-B REVIEW ARTICLE Long-distance interactions between enhancers and promoters The case of the Abd-B domain of the Drosophila bithorax complex La ´ szlo ´ Sipos ... regulation of the homeotic Abdominal-B (Abd-B) gene in Drosophila. Abd-B, one of the three genes in the bithorax compl...

Ngày tải lên: 20/02/2014, 01:20

7 719 0
Tài liệu Báo cáo khoa học: "NATURAL LANGUAGE AND COMPUTER INTEBFACE DESIGN MURRAY TUROFF DEPARTMENT OF COMPUTER AND IiVFORMATION SCIENCE IIEW JERSEY INSTITUTE OF TECHNOLOGY" ppt

Tài liệu Báo cáo khoa học: "NATURAL LANGUAGE AND COMPUTER INTEBFACE DESIGN MURRAY TUROFF DEPARTMENT OF COMPUTER AND IiVFORMATION SCIENCE IIEW JERSEY INSTITUTE OF TECHNOLOGY" ppt

... NATURAL LANGUAGE AND COMPUTER INTEBFACE DESIGN MURRAY TUROFF DEPARTMENT OF COMPU%'z~ AND IiVFORMATION SCIENCE IIEW JERSEY INSTITUTE OF TECHNOLOGY SOME ICONOCLASTIC ... first impression of what a computer is like. COMPUTERIZED CONFERENCING Since 1973 at the New Jersey Institute of Technology, we have been developing and evaluating the use...

Ngày tải lên: 21/02/2014, 20:20

2 465 0
Báo cáo khoa học: Cyclic ADP-ribose requires CD38 to regulate the release of ATP in visceral smooth muscle ppt

Báo cáo khoa học: Cyclic ADP-ribose requires CD38 to regulate the release of ATP in visceral smooth muscle ppt

... preparation. Of particular importance is the finding that exogenous cADPR failed to increase the spontaneous release of ATP in the absence of CD38. In other words, the presence of CD38 is mandatory for the ... enhanced the spontane- ous release of ATP but not the release of ATP evoked by action potential firings. The enhancing effect of cADPR o...

Ngày tải lên: 05/03/2014, 23:20

14 509 0
Báo cáo khoa học: Nuclear actin and actin-binding proteins in the regulation of transcription and gene expression docx

Báo cáo khoa học: Nuclear actin and actin-binding proteins in the regulation of transcription and gene expression docx

... muscles and several cancer cell lines [94]. Table 1. Role of nuclear actin- binding proteins interacting with the androgen receptor. AR, androgen receptor; LBD, ligand-binding domain. Actin- binding protein Targeting sequence ... ARTICLE Nuclear actin and actin- binding proteins in the regulation of transcription and gene expression Bin Zheng 1 , Mei Han 1...

Ngày tải lên: 07/03/2014, 01:20

17 574 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

... (Paris, France): 5forGulox (forward), 5Â-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3Â; and 3rev- Gulox (reverse), 5Â-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT A- 3Â. ... Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase Beata A. Wolucka 1 an...

Ngày tải lên: 07/03/2014, 12:20

11 571 0
Báo cáo khoa học: Nautilin-63, a novel acidic glycoprotein from the shell nacre of Nautilus macromphalus doc

Báo cáo khoa học: Nautilin-63, a novel acidic glycoprotein from the shell nacre of Nautilus macromphalus doc

... 2011 The Authors Journal compilation ª 2011 FEBS Nautilin-63, a novel acidic glycoprotein from the shell nacre of Nautilus macromphalus Benjamin Marie 1,2 , Isabelle Zanella-Cle ´ on 3 , Marion ... CaCO 3 precipitation. First, the effect of the nacre matrix started to occur above 1 lg of the ASM and the delay of the reaction was dose- dependent. At...

Ngày tải lên: 22/03/2014, 16:20

14 383 0
Báo cáo khoa học: Novel c-carboxyglutamic acid-containing peptides from the venom of Conus textile docx

Báo cáo khoa học: Novel c-carboxyglutamic acid-containing peptides from the venom of Conus textile docx

... the mechanistic properties of an ancestral carboxylation system. Here, we describe the purification and characteriza- tion of four novel Gla-containing conotoxins from C. textile. All of the peptides ... to )1). The propeptide regions of the conotoxins reported here share structural and physico- chemical properties with the pro- and postpeptides of other Gla-contai...

Ngày tải lên: 23/03/2014, 11:20

10 437 0
Báo cáo khoa học: A new highly toxic protein isolated from the death cap Amanita phalloides is an L-amino acid oxidase pdf

Báo cáo khoa học: A new highly toxic protein isolated from the death cap Amanita phalloides is an L-amino acid oxidase pdf

... protein isolated from the death cap Amanita phalloides is an L-amino acid oxidase Taras Stasyk 1,2 , Maxim Lutsik-Kordovsky 1 , Christer Wernstedt 3 , Volodymyr Antonyuk 1 , Olga Klyuchivska 1 , ... pro- tein from death cap Amanita phalloides: isolation and study of cytotoxic activity. Studia Biologica 2, 21–32. 17 Martin F, Aerts A, Ahre ´ n D, Brun A, Da...

Ngày tải lên: 29/03/2014, 08:20

10 474 0
Báo cáo khoa học: A Kazal prolyl endopeptidase inhibitor isolated from the skin of Phyllomedusa sauvagii pdf

Báo cáo khoa học: A Kazal prolyl endopeptidase inhibitor isolated from the skin of Phyllomedusa sauvagii pdf

... two variants of a new protein isolated from the skin of the anuran, P. sauvagii, whose sequence indicates membership of the Kazal family. Most members of this family are small protein inhibitors of ... acrosin – the major protease of mammalian spermatozoa – from the crab-eating monkey, Macaca fascicularis (Table 1). Whereas many Kazal inhibitors have proli...

Ngày tải lên: 30/03/2014, 13:20

10 456 0
Báo cáo khoa học: "Radial variations in wood mineral element concentrations: a comparison of beech and pedunculate oak from the Belgian Ardennes" pps

Báo cáo khoa học: "Radial variations in wood mineral element concentrations: a comparison of beech and pedunculate oak from the Belgian Ardennes" pps

... Original article Radial variations in wood mineral element concentrations: a comparison of beech and pedunculate oak from the Belgian Ardennes Valérie Penninckx, Suzanne Glineur, Wolf ... Comparison of oak and beech There are striking differences in mineral element con- centration profiles in the wood of oak and beech growing at t...

Ngày tải lên: 08/08/2014, 14:21

8 230 0
báo cáo khoa học: "Hepatocyte growth factor incorporated chitosan nanoparticles augment the differentiation of stem cell into hepatocytes for the recovery of liver cirrhosis in mice" pptx

báo cáo khoa học: "Hepatocyte growth factor incorporated chitosan nanoparticles augment the differentiation of stem cell into hepatocytes for the recovery of liver cirrhosis in mice" pptx

... al.: Hepatocyte growth factor incorporated chitosan nanoparticles augment the differentiation of stem cell into hepatocytes for the recovery of liver cirrhosis in mice. Journal of Nanobiotechnology ... Open Access Hepatocyte growth factor incorporated chitosan nanoparticles augment the differentiation of stem cell into hepatoc...

Ngày tải lên: 11/08/2014, 00:23

11 404 0
Từ khóa:
w