Báo cáo khoa học: "Recent footrot outbreak in Debrezeit swin

Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"

... treatment and potential links to data quality. This understanding provides insight into potential errors (bias and random error) related to data based on clinical examina- Acta Veterinaria ... data and decision making in relation to treatment of metritis and their motiva- tion to produce data. This information was condensed into a 'model of understandi...

Ngày tải lên : 25/10/2012, 10:45

10
587
0

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... TCTTTGACTTCTCAAACTGATCG RPE6 5a- His-Fwd NM_200751 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC RPE65c-His-Fwd NM_001113653 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC Y. Takahashi ... subcellular fractionation To analyze the cellular localization of zebrafish RPE65c in the retina, we generated an antibody using a specific zebrafish RPE65c peptide, and the specifici...

Ngày tải lên : 14/02/2014, 14:20

14
753
0

Tài liệu Báo cáo khoa học: Applications and trends in systems biology in biochemistry docx

... found using the keyword systems biology actually reﬂect applications of systems biology approaches to biological systems resulting in new biological insights. However, on the other hand, and ... Hormone, cytokinins Nicotiana tabacum Modeling and measuring of the dynamics of endogenous cytokinins in tobacco plants grown on media supplemented with isopentenyl ade nine, zeat...

Ngày tải lên : 14/02/2014, 14:20

91
733
0

Tài liệu Báo cáo khoa học: TEC family kinases in health and disease – loss-of-function of BTK and ITK and the gain-of-function fusions ITK–SYK and BTK–SYK pptx

... phosphorylation levels of BTK SYK. ITK SYK was highly phosphorylated in both COS7 and 293T cells and did not vary like BTK SYK; therefore, the differences in the PH–TH domains remain the decisive factor ... capacity, we constructed the corresponding fusion kinase BTK SYK, harboring the PH–TH domain doublet (amino acids 1–1 96) of BTK fused with the linker B kin...

Ngày tải lên : 14/02/2014, 18:20

10
926
0

Báo cáo khoa học: Recent contributions of in vitro models to our understanding of hepatitis C virus life cycle pdf

... and selection of quasispecies during the culture of infected hepatocytes. To succeed in obtaining HCV infection in primary human hepatocytes, an existing model of hepatitis B virus infection ... and CD81 has been shown to be critical for HCVcc infectivity. In fact, antibodies directed against CD81 and CD81 downregulation with RNA interfer- ence inhibited HCVcc entry into H...

Ngày tải lên : 16/03/2014, 05:20

14
532
0

Báo cáo khoa học: "Recent footrot outbreak in Debrezeit swine farm, central Ethiopia" ppsx

Ngày tải lên : 07/08/2014, 18:21

2
124
0

Báo cáo khoa học: " Porcine abortion outbreak associated with Toxoplasma gondii in Jeju Island, Korea" pot

... reported in young piglets, little was known of abortions associated with T. gondii and rates of congenital infection in pigs [2]. Epidemiologically, porcine toxoplasmosis has been classified into ... mortality rate ranged from 10% to 42% in fattening pigs weighing 60 to 180 kg. In Taiwan, 51 of 66 pregnant gilts infected with T. gondii on a single farm aborted within...

Ngày tải lên : 07/08/2014, 23:22

5
435
0

Báo cáo khoa học: "Recent advances in the surgical care of breast cancer patients" pps

... 5 years at the multivariate analysis [237]. In the US this information has resulted in a rapid increment of Breast Fellowship, recognizing that appro- priate training is one of the key factors in improving quality ... have resulted both in an increasing percentage of small breast cancers found at the initial diagnosis and in a small decline in mortality [2]. Howe...

Ngày tải lên : 09/08/2014, 03:21

17
514
0

báo cáo khoa học: "Recent advances of novel targeted therapy in non-small cell lung cancer" pot

... phase II study of cetuximab plus cisplatin/vinorelbine compared with cisplatin/vinorelbine alone as first-line therapy in EGFR- expressing advanced non-small- cell lung cancer. Ann Oncol 2008 in press. 34. ... trial comparing bexarotene (L1069-49)/cisplatin/vinorelbine with cisplatin/vinorelbine in chemotherapy-naive patients with advanced or metastatic non-small- cell lung...

Ngày tải lên : 10/08/2014, 22:20

18
390
0

báo cáo khoa học: "Recent advances in gastrointestinal oncology updates and insights from the 2009 annual meeting of the American Society of Clinical Oncology" doc

... REVIEW Open Access Recent advances in gastrointestinal oncology - updates and insights from the 2009 annual meeting of the American Society of Clinical Oncology Milind Javle 1 , Chung-Tsen Hsueh 2* Abstract We ... Clin Oncol (Meeting Abstracts) 2009, 27(18S):LBA4007. 56. Javle M, Hsueh CT: Updates in Gastrointestinal Oncology - insights from...

Ngày tải lên : 10/08/2014, 22:20

11
530
0

báo cáo khoa học: " Recent advances in the genetics of language impairment" docx

... difficulties controlling the movement and sequencing of orofacial muscles, causing deficits in the production of fluent speech. In- depth studies of the KE family showed that, in these individuals, speech ... understanding of language disorders and improve our understanding of the biological foundations of language acquisition. â 2010 BioMed Central Ltd Recent...

Ngày tải lên : 11/08/2014, 12:20

8
547
0

báo cáo khoa học: " Recent insights into the role of NF-κB in ovarian carcinogenesis" pot

... AB: Recent insights into the role of NF-κB in ovarian carcinogenesis. Genome Medicine 2010, 2:56. Alvero Genome Medicine 2010, 2:56 http://genomemedicine.com/content/2/8/56 Page 3 of 3 in the ... pathway. Abbreviations EOC, epithelial ovarian cancer cells; IKKα, inhibitor of NF-κB kinase α; IKKβ, inhibitor of NF-κB kinase β; IκB, inhibitor of NFκB; IL, i...

Ngày tải lên : 11/08/2014, 12:20

3
260
0

báo cáo khoa học:" Recent technological developments: in situ histopathological interrogation of surgical tissues and resection margins" ppt

... purposes) Head & Face Medicine Open Access Research Recent technological developments: in situ histopathological interrogation of surgical tissues and resection margins Tahwinder Upile* 1,3,6,7 , ... advance the type of surgical margin we take from the standard clinically visible margin to that of a histopathological margin. In the near future we may even...

Ngày tải lên : 11/08/2014, 23:22

12
296
0

Báo cáo khoa học: "Drotrecogin alfa (activated) in patients with severe sepsis presenting with purpura fulminans, meningitis, or meningococcal disease: a retrospective analysis of patients enrolled in recent clinical studies" ppt

... Indianapolis, IN, USA 7 Clinical Development Associate, Lilly Research Laboratories, Indianapolis, IN, USA 8 Associate Global Medical Information Consultant, Lilly Research Laboratories, Indianapolis, IN, ... http://ccforum.com/content/9/4/R331 R331 Vol 9 No 4 Research Drotrecogin alfa (activated) in patients with severe sepsis presenting with purpura fulminans,...

Ngày tải lên : 12/08/2014, 22:21

13
361
0

Báo cáo khoa học: "Recent evolution of renal replacement therapy in the critically ill patient" pptx

... therapy of the critically ill patient with renal and other organ dysfunction is given in Fig. 2. The last generation of machines available on the market today and representing the evolution of ... hemofiltration, or the combined use of adsorbent techniques in systems where the Commentary Recent evolution of renal replacement therapy in the crit...

Ngày tải lên : 12/08/2014, 23:22

5
331
0