Báo cáo khoa học: "Experimental reproduction of proliferative enteropathy and the role of IFN-gamma in protective immunity against Lawsonia intracellularis in mice" pdf

Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

... GGGTTCT AACAAG GGTGCT-3Â;Abc, 5Â-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3Â;Ab- start, 5Â-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3Â;Abstop, 5Â-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3Â. The ... according to the manufacturer’s guidelines and using the following primers: Aba, 5Â-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3Â;Abb, 5Â-GTTCACCACCAGAAGCT GGTGT...

Ngày tải lên: 18/02/2014, 13:20

16 691 0
Tài liệu Báo cáo khoa học: An engineered disulfide bridge mimics the effect of calcium to protect neutral protease against local unfolding docx

Tài liệu Báo cáo khoa học: An engineered disulfide bridge mimics the effect of calcium to protect neutral protease against local unfolding docx

... FEBS An engineered disulfide bridge mimics the effect of calcium to protect neutral protease against local unfolding Peter Du ă rrschmidt*, Johanna Mansfeld and Renate Ulbrich-Hofmann Department of ... Model of the 3D structure of the neutral protease from Bacillus stearothermo- philus, including the position of the disulfide bridge in mu...

Ngày tải lên: 19/02/2014, 17:20

12 610 0
Tài liệu Báo cáo khoa học: "From HOPE en I''''ESPERANCE On the Role of Computational Neurolinguistics in Cross-Language Studies " pptx

Tài liệu Báo cáo khoa học: "From HOPE en I''''ESPERANCE On the Role of Computational Neurolinguistics in Cross-Language Studies " pptx

... meaning. It is the in interaction of the results of these asynchronous processes that the process of comprehension is defined. The processes are independent of the know- ledge representations ... activation of all meanings of each recognized word in HOPE, the determination of the phonetic representation of a recognized word determines the breadth o...

Ngày tải lên: 21/02/2014, 20:20

5 610 0
Tài liệu Báo cáo khoa học: "Language Resources Factory: case study on the acquisition of Translation Memories" potx

Tài liệu Báo cáo khoa học: "Language Resources Factory: case study on the acquisition of Translation Memories" potx

... Association for Computational Linguistics Language Resources Factory: case study on the acquisition of Translation Memories ∗ Marc Poch UPF Barcelona, Spain marc.pochriera@upf.edu Antonio Toral DCU ... this case only the WSP needs to have a deep knowledge of the installation and maintenance of the tool, thus allowing all the other users to benefit 1 6 Evaluatio...

Ngày tải lên: 22/02/2014, 03:20

5 532 0
Tài liệu Báo cáo Y học: The effects of low pH on the properties of protochlorophyllide oxidoreductase and the organization of prolamellar bodies of maize (Zea mays) pot

Tài liệu Báo cáo Y học: The effects of low pH on the properties of protochlorophyllide oxidoreductase and the organization of prolamellar bodies of maize (Zea mays) pot

... form of a phosphorylated (or possibly adenylated) ternary complex of POR, its substrate PChlide, and NADPH. Dephospho- rylation of the photoconverted form of this complex by an endogenous phosphatase, ... 12B. The effect of the presence of the adenylates on the ability of POR-PChlide 640 to undergo photoconversion was checked by comparing the efficiency of photo...

Ngày tải lên: 22/02/2014, 04:20

11 638 0
Báo cáo khoa học: A novel 2D-based approach to the discovery of candidate substrates for the metalloendopeptidase meprin pot

Báo cáo khoa học: A novel 2D-based approach to the discovery of candidate substrates for the metalloendopeptidase meprin pot

... may speculate that hmeprin has activity similar to BMP-1 ⁄ TLD-like metalloendopeptidases in that it acts as a procollagen C protease as well as an activator of lysyl oxidase. Therefore, an important ... residues, vari- able oxidation of methionine and variable deamidation of asparagine and glutamine. Parent and fragment mass toler- ances were set to 1 Da. Up to two missed cleav...

Ngày tải lên: 07/03/2014, 06:20

20 506 0
Báo cáo khoa học: Purification, characterization, cDNA cloning and nucleotide sequencing of a cellulase from the yellow-spotted longicorn beetle, Psacothea hilaris ppt

Báo cáo khoa học: Purification, characterization, cDNA cloning and nucleotide sequencing of a cellulase from the yellow-spotted longicorn beetle, Psacothea hilaris ppt

... primers designed from the cDNA sequence resulted in the amplification of bands in each case. Sequencing of these bands showed that they matched the sequence of the cellulase cDNA completely; however, ... conditions [4,18,19]. The optimal pH for the purified cellulase from the larval gut of P. hilaris against CMC was also 5.5. This is reasonable for the ph...

Ngày tải lên: 17/03/2014, 10:20

6 361 0
Báo cáo khoa học: "Last but Definitely not Least: On the Role of the Last Sentence in Automatic Polarity-Classification" pdf

Báo cáo khoa học: "Last but Definitely not Least: On the Role of the Last Sentence in Automatic Polarity-Classification" pdf

... 2010. c 2010 Association for Computational Linguistics Last but Definitely not Least: On the Role of the Last Sentence in Automatic Polarity-Classification Israela Becker and Vered Aharonson AFEKA – ... experiment we examined the readers’ rating of the same re- views based on reading single sentences ex- tracted from these reviews: the last sente...

Ngày tải lên: 23/03/2014, 16:20

5 356 0
Báo cáo khoa học: Tec family kinases: Itk signaling and the development of NKT ab and cd T cells potx

Báo cáo khoa học: Tec family kinases: Itk signaling and the development of NKT ab and cd T cells potx

... role of Itk in T- cell development. In the absence of Itk, there is a partial block in the development of ab T cells and a reduced ratio of CD4 to CD8 single positive thy- mocytes in both the thymus ... from conventional ab T cells. This minireview focuses on this aspect of Itk, its role in the development and function of iNKT and NKT- like...

Ngày tải lên: 28/03/2014, 22:21

10 454 0
Báo cáo khoa học: " Risk factors for retained placenta and the effect of retained placenta on the occurrence of postpartum diseases and subsequent reproductive performance in dairy cows" potx

Báo cáo khoa học: " Risk factors for retained placenta and the effect of retained placenta on the occurrence of postpartum diseases and subsequent reproductive performance in dairy cows" potx

... (2005), / 6 (1), 53–59 Risk factors for retained placenta and the effect of retained placenta on the occurrence of postpartum diseases and subsequent reproductive performance in dairy cows Yeon-Kyung Han, ... several reproductive factors in individual cows, and to determine the effects of retained placenta on the occurrence...

Ngày tải lên: 07/08/2014, 18:21

7 465 1
Báo cáo khoa học: "morphological characteristics, root growth potential and flushing response of rooted cuttings compared with transplants of Sitka spruce" pps

Báo cáo khoa học: "morphological characteristics, root growth potential and flushing response of rooted cuttings compared with transplants of Sitka spruce" pps

... between 15 and 22 °C. Original article The morphological characteristics, root growth potential and flushing response of rooted cuttings compared with transplants of Sitka spruce Conor ... in root growth potential and flushing response of rooted cuttings derived from selected material compared with unim- proved transplants o...

Ngày tải lên: 08/08/2014, 14:21

10 402 0
Báo cáo khoa hoc:" VEGF receptors on PC12 cells mediate transient activation of ERK1/2 and Akt: comparison of nerve growth factor and vascular endothelial growth factor" doc

Báo cáo khoa hoc:" VEGF receptors on PC12 cells mediate transient activation of ERK1/2 and Akt: comparison of nerve growth factor and vascular endothelial growth factor" doc

... expression of VEGF receptors on PC12 cells, exogenous VEGF 165 had no effect on PC12 cell pro- liferation and neurite formation. One reason might be endogenous VEGF- expression of proliferating PC12 ... 1 of 6 (page number not for citation purposes) Journal of Negative Results in BioMedicine Open Access Research VEGF receptors on PC12 cells mediate t...

Ngày tải lên: 11/08/2014, 08:20

6 275 0
báo cáo khoa học: " Coerced addiction treatment: Client perspectives and the implications of their neglect" pps

báo cáo khoa học: " Coerced addiction treatment: Client perspectives and the implications of their neglect" pps

... cited. Review Coerced addiction treatment: Client perspectives and the implications of their neglect Karen A Urbanoski Abstract Recent work has criticized the evidence base for the effectiveness of addiction ... excluded, as they are out of the scope of the present review. This includes studies of the effectiveness of applying sanctions and rewards...

Ngày tải lên: 11/08/2014, 18:20

10 328 0
Báo cáo khoa học: "A Clinical review: Molecular mechanisms underlying the role of antithrombin in sepsis" docx

Báo cáo khoa học: "A Clinical review: Molecular mechanisms underlying the role of antithrombin in sepsis" docx

... circulating antithrombins are glycosylated at four of their asparagine molecules; these are of the α isoform. The remaining 5–15% of circulating antithrombins, of the β isoform, lack glycosy- lation at asparagine ... effect in a rat model by intravital videomicroscopy of damage to the small intestine in endotoxinaemia. In both of these studies, the effect of ant...

Ngày tải lên: 12/08/2014, 23:21

9 393 0
w