Báo cáo khoa học: "Comparison of an enzyme-linked immunosorbent assay with serum neutralization test for serodiagnosis of porcine epidemic diarrhea virus infection" pdf

Tài liệu Báo cáo khoa học: Comparison of membrane fraction proteomic profiles of normal and cancerous human colorectal tissues with gel-assisted digestion and iTRAQ labeling mass spectrometry pptx

Tài liệu Báo cáo khoa học: Comparison of membrane fraction proteomic profiles of normal and cancerous human colorectal tissues with gel-assisted digestion and iTRAQ labeling mass spectrometry pptx

... Comparison of membrane fraction proteomic profiles of normal and cancerous human colorectal tissues with gel-assisted digestion and iTRAQ labeling mass spectrometry Jinn-Shiun Chen 1,2 , Kuei-Tien ... isobaric tags with related and absolute quantitation (iTRAQ) labeling and LC-MS ⁄ MS for quantitative analysis of the membrane proteome of...

Ngày tải lên: 16/02/2014, 15:20

11 590 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

... GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC cyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG cyc1-z GCATCAGAAAGCATAGGC cyc1-m TGGGAATACGATAGAGTAG nb2 primer GTTTAAACGAGCTCGAATTC Coq7 in fission yeast ... CCGTCGACCAAGCTTATGTTTCCTTATTTTTACAGACG ScCoq7-b CCCCCGGGGCCACTTTCTGGTG Spcoq7 -a GTACAAGCTTGTAAATTTTCGATGG Spcoq7-b CATAGAATTCTTGGTAATC Spcoq7-c AAAGTCGACATGTTGTCACGTAGACAG Spcoq7-w...

Ngày tải lên: 18/02/2014, 14:20

16 646 0
Tài liệu Báo cáo khoa học: Comparison of the substrate specificity of two potyvirus proteases doc

Tài liệu Báo cáo khoa học: Comparison of the substrate specificity of two potyvirus proteases doc

... modeling, the Arg side chain of the substrate may partially compensate for the loss of the Lys side Table 1. Comparison of the specificity of TEV and TVMV proteases. The relative specificity constants ... 0.15 ± 0.04 75 19 Comparison of two potyvirus proteases J. To ă zse r et al. 520 FEBS Journal 272 (2005) 514523 ê 2004 FEBS Comparison of the su...

Ngày tải lên: 19/02/2014, 16:20

10 524 0
Tài liệu Báo cáo khoa học: N-Methyl-L-amino acid dehydrogenase from Pseudomonas putida A novel member of an unusual NAD(P)-dependent oxidoreductase superfamily ppt

Tài liệu Báo cáo khoa học: N-Methyl-L-amino acid dehydrogenase from Pseudomonas putida A novel member of an unusual NAD(P)-dependent oxidoreductase superfamily ppt

... were of analytical grade from Nacalai Tesque (Kyoto, Japan) and Wako Pure Chemical Industries (Osaka, Japan). Culture and screening of bacteria Bacterial strains were cultivated for 15–20 h at ... & Komagata K (1992) Transfer of Pseudomonas- Amino- vorans (Dendooren Dejong 1926) to Aminobacter General-Nov as Aminobacter-Aminovorans Comb-Nov and description of Aminobacter-Aganoe...

Ngày tải lên: 19/02/2014, 16:20

7 518 0
Báo cáo khoa học: "Redundancy Ratio: An Invariant Property of the Consonant Inventories of the World’s Languages" pdf

Báo cáo khoa học: "Redundancy Ratio: An Invariant Property of the Consonant Inventories of the World’s Languages" pdf

... span a much larger range for the vowel inventories than for the consonant inventories. The significance of the difference in the nature of the distribution of RRs for the vowel and the conso- nant ... measure of redun- dancy is almost an invariance over the consonant inventories of the world’s languages. The observa- tion is important since it can s...

Ngày tải lên: 17/03/2014, 04:20

8 366 0
Báo cáo khoa học: Comparison of functional properties of two fungal antifreeze proteins from Antarctomyces psychrotrophicus and Typhula ishikariensis ppt

Báo cáo khoa học: Comparison of functional properties of two fungal antifreeze proteins from Antarctomyces psychrotrophicus and Typhula ishikariensis ppt

... include two major fungal taxa of ascomycetes and basidio- mycetes and one pseudofungal taxon of oomycetes. Among them, AFP was only identified in the basid- iomycetes Coprinus psychromorbidus [15] and ... results of a comparison of the concentration dependence of TH activity among AnpAFP, TisAFP and fish type III AFP. It also shows the concentration dependence of TH o...

Ngày tải lên: 22/03/2014, 21:20

10 433 0
Báo cáo khoa học: Comparison of human RNase 3 and RNase 7 bactericidal action at the Gram-negative and Gram-positive bacterial cell wall pot

Báo cáo khoa học: Comparison of human RNase 3 and RNase 7 bactericidal action at the Gram-negative and Gram-positive bacterial cell wall pot

... microscope RNase 3 and RNase 7 bactericidal activity M. Torrent et al. 172 2 FEBS Journal 277 (2010) 17 131 72 5 ê 2010 The Authors Journal compilation ê 2010 FEBS Comparison of human RNase 3 and RNase 7 bactericidal action ... from the time course of E. coli cell incubation with RNase 3. Left lanes: control cells; right lanes: cells incubated w...

Ngày tải lên: 22/03/2014, 21:20

13 465 0
Báo cáo khoa học: "Combining Lexical, Syntactic, and Semantic Features with Maximum Entropy Models for Extracting Relations" pptx

Báo cáo khoa học: "Combining Lexical, Syntactic, and Semantic Features with Maximum Entropy Models for Extracting Relations" pptx

... Combining Lexical, Syntactic, and Semantic Features with Maximum Entropy Models for Extracting Relations Nanda Kambhatla IBM T. J. Watson Research Center 1101 ... observations in section 4. 2 Maximum Entropy models for extracting relations We built Maximum Entropy models for predicting the type of relation (if any) between every pair of mentions within...

Ngày tải lên: 31/03/2014, 03:20

4 294 0
Báo cáo khoa học: "High grade B-cell gastric lymphoma with complete pathologic remission after eradication of helicobacter pylori infection: Report of a case and review of the literature" pdf

Báo cáo khoa học: "High grade B-cell gastric lymphoma with complete pathologic remission after eradication of helicobacter pylori infection: Report of a case and review of the literature" pdf

... eradication of helicobacter pylori infection: Report of a case and review of the literature Luigi Cavanna* 1 , Raffaella Pagani 1 , Pietro Seghini 1 , Adriano Zangrandi 2 and Carlo Paties 2 Address: ... effect of eradication of Helicobacter pylori as first line therapy in gastric high grade gastric lymphoma: 22 of a total of 38 (57.9%) enro...

Ngày tải lên: 09/08/2014, 07:21

7 374 0
Báo cáo khoa học: " Neoadjuvant capecitabine, radiotherapy, and bevacizumab (CRAB) in locally advanced rectal cancer: results of an open-label phase II study" docx

Báo cáo khoa học: " Neoadjuvant capecitabine, radiotherapy, and bevacizumab (CRAB) in locally advanced rectal cancer: results of an open-label phase II study" docx

... RESEARCH Open Access Neoadjuvant capecitabine, radiotherapy, and bevacizumab (CRAB) in locally advanced rectal cancer: results of an open-label phase II study Vaneja Velenik 1* , Janja Ocvirk 1 , ... safety and efficacy of bevacizumab in combination with che- motherapy and radiation in the neoadjuvant setting [30-34]. In this study we explor...

Ngày tải lên: 09/08/2014, 09:21

8 474 0
Báo cáo khoa học: " What is an acceptably smoothed fluence? Dosimetric and delivery considerations for dynamic sliding window IMRT" ppt

Báo cáo khoa học: " What is an acceptably smoothed fluence? Dosimetric and delivery considerations for dynamic sliding window IMRT" ppt

... Oncology Open Access Research What is an acceptably smoothed fluence? Dosimetric and delivery considerations for dynamic sliding window IMRT Nicolini Giorgia 1 , Fogliata Antonella 1 , Vanetti Eugenio 1,2 , ... conditions s25 and s80Figure 4 DVHs of targets and organs at risk (Head and Neck case) for the two extreme smoothing conditions s25 and s80. Table...

Ngày tải lên: 09/08/2014, 10:21

13 332 0
báo cáo khoa học: "Percutaneous pedicle screw reduction and axial presacral lumbar interbody fusion for treatment of lumbosacral spondylolisthesis: A case series" pdf

báo cáo khoa học: "Percutaneous pedicle screw reduction and axial presacral lumbar interbody fusion for treatment of lumbosacral spondylolisthesis: A case series" pdf

... 18-year history of axial low back pain and a one-year history of radiculopathy. The pain was described as 8 out of 10 on average and 10 out of 10 at its worst, of mechanical type, and refractory ... patients treatment alternatives with lower operative morbidity risk. The combination of percutaneous pedicle screw reduction and an axial presacral approach fo...

Ngày tải lên: 10/08/2014, 23:20

6 342 0
báo cáo khoa học:" Obesity and craniofacial variables in subjects with obstructive sleep apnea syndrome: comparisons of cephalometric values" ppsx

báo cáo khoa học:" Obesity and craniofacial variables in subjects with obstructive sleep apnea syndrome: comparisons of cephalometric values" ppsx

... 1 of 9 (page number not for citation purposes) Head & Face Medicine Open Access Review Obesity and craniofacial variables in subjects with obstructive sleep apnea syndrome: comparisons of ... problems in the cognitive sphere. Apnea can be defined as an interruption of breath- ing during sleep, with persistence of thoracic and/ or abdominal movements...

Ngày tải lên: 12/08/2014, 00:20

9 241 0
báo cáo khoa học: " AtMRP6/AtABCC6, an ATP-Binding Cassette transporter gene expressed during early steps of seedling development and up-regulated by cadmium in Arabidopsis thaliana" doc

báo cáo khoa học: " AtMRP6/AtABCC6, an ATP-Binding Cassette transporter gene expressed during early steps of seedling development and up-regulated by cadmium in Arabidopsis thaliana" doc

... are ABC transporters [6,7]. The ATP-binding cassette (ABC) superfamily is the largest family of transporters in living organisms, ranging from bacteria to humans [8-10]. In humans, ABC transporters have ... 1 of 11 (page number not for citation purposes) BMC Plant Biology Open Access Research article AtMRP6/AtABCC6, an ATP-Binding Cassette transporter gene expressed...

Ngày tải lên: 12/08/2014, 05:20

11 251 0
w