Báo cáo khoa học: "Comparison of an enzyme-linked immunosorbent assay with serum neutralization test for serodiagnosis of porcine epidemic diarrhea virus infection" pdf

$Tài liệu Báo cáo khoa học: Comparison of membrane fraction proteomic proﬁles of normal and cancerous human colorectal tissues with gel-assisted digestion and iTRAQ labeling mass spectrometry pptx$

Tài liệu Báo cáo khoa học: Comparison of membrane fraction proteomic proﬁles of normal and cancerous human colorectal tissues with gel-assisted digestion and iTRAQ labeling mass spectrometry pptx

... Comparison of membrane fraction proteomic proﬁles of normal and cancerous human colorectal tissues with gel-assisted digestion and iTRAQ labeling mass spectrometry Jinn-Shiun Chen1,2, Kuei-Tien ... isobarictags with related and absolute quantitation (iTRAQ) labeling and LC-MS ⁄ MS for quantitative analysis of the membrane proteome of colorectal tissue. In brief, membrane proteins were solubilized with ... labeled with iTRAQ 114 and pep-tides from tumor tissue of the same patient were labeled with iTRAQ 115. The resulting peptides from normal tissue of another patient were labeled with iTRAQ 116and...

Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in ﬁssion yeast doc

... GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGCcyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTGcyc1-z GCATCAGAAAGCATAGGCcyc1-m TGGGAATACGATAGAGTAGnb2 primer GTTTAAACGAGCTCGAATTC Coq7 in ﬁssion yeast ... CCGTCGACCAAGCTTATGTTTCCTTATTTTTACAGACGScCoq7-b CCCCCGGGGCCACTTTCTGGTGSpcoq7 -a GTACAAGCTTGTAAATTTTCGATGGSpcoq7-b CATAGAATTCTTGGTAATCSpcoq7-c AAAGTCGACATGTTGTCACGTAGACAGSpcoq7-w CAAGCAGGTGAATTAGGCSpcoq7-x ... CAAGCAGGTGAATTAGGCSpcoq7-x GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATCSpcoq7-y GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATGSpcoq7-z CAGGCAAGTCTGTTTATTGSpcoq7-m CTTGGATGAGCTTTCCACSpcoq3-w CGTATAAATTACAATACCGSpcoq3-x...

Tài liệu Báo cáo khoa học: Comparison of the substrate speciﬁcity of two potyvirus proteases doc

... modeling, the Arg side chain of the substrate may partially compensate for the loss of the Lys sideTable 1. Comparison of the speciﬁcity of TEV and TVMV proteases. The relative speciﬁcity constants ... 0.15 ± 0.04 75 19 Comparison of two potyvirus proteases J. Toăzser et al.520 FEBS Journal 272 (2005) 514523 ê 2004 FEBS Comparison of the substrate specicity of two potyvirus proteases Jozsef ... with the corresponding residues of TVMV protease. Kinetic analyses of the mutants conﬁrmed that these resi-dues play a role in the speciﬁcity of the two enzymes. Additional residuesin the substrate- binding...

Tài liệu Báo cáo khoa học: N-Methyl-L-amino acid dehydrogenase from Pseudomonas putida A novel member of an unusual NAD(P)-dependent oxidoreductase superfamily ppt

... were of analytical grade from Nacalai Tesque (Kyoto, Japan) andWako Pure Chemical Industries (Osaka, Japan).Culture and screening of bacteriaBacterial strains were cultivated for 15–20 h at ... &Komagata K (1992) Transfer of Pseudomonas- Amino-vorans (Dendooren Dejong 1926) to AminobacterGeneral-Nov as Aminobacter-Aminovorans Comb-Novand description of Aminobacter-Aganoensis Sp-Novand ... c, myokinase, enolase, lactate dehydrogenase, andglutamate dehydrogenase from Oriental Yeast, Osaka,Japan.Other analytical methodsThe N-terminal amino -acid sequence of the enzyme wasdetermined...

Báo cáo khoa học: "Redundancy Ratio: An Invariant Property of the Consonant Inventories of the World’s Languages" pdf

... span amuch larger range for the vowel inventories than for the consonant inventories. The signiﬁcance of the difference in the nature of the distribution of RRs for the vowel and the conso-nant ... measure of redun-dancy is almost an invariance over the consonant inventories of the world’s languages. The observa-tion is important since it can shed enough light on the organization of the consonant ... LinguisticsRedundancy Ratio: An Invariant Property of the Consonant Inventories of the World’s LanguagesAnimesh Mukherjee, Monojit Choudhury, Anupam Basu, Niloy GangulyDepartment of Computer Science and Engineering,Indian...

Báo cáo khoa học: Comparison of functional properties of two fungal antifreeze proteins from Antarctomyces psychrotrophicus and Typhula ishikariensis ppt

... include two major fungal taxa of ascomycetes and basidio-mycetes and one pseudofungal taxon of oomycetes.Among them, AFP was only identiﬁed in the basid-iomycetes Coprinus psychromorbidus [15] and ... results of a comparison of theconcentration dependence of TH activity amongAnpAFP, TisAFP and ﬁsh type III AFP. It also showsthe concentration dependence of TH of a recombinantTisAFP isoform ... consists of approximately 10 isoforms. Here, AnpAFP, TisAFP and AFPIII (Fig. 5) consist of a mixture of AFP iso-forms in A. psychrotrophicus, Typhula ishikariensis and Zoarces elongatus, respectively....

Báo cáo khoa học: Comparison of human RNase 3 and RNase 7 bactericidal action at the Gram-negative and Gram-positive bacterial cell wall pot

... microscope RNase 3 and RNase 7 bactericidal activity M. Torrent et al. 172 2 FEBS Journal 277 (2010) 17 131 72 5 ê 2010 The Authors Journal compilation ê 2010 FEBS Comparison of human RNase 3 and RNase 7 bactericidal action ... from the time course of E. coli cell incubation with RNase 3. Left lanes: control cells; right lanes: cells incubated with 5 lM of RNase 3 at 0, 1, 2, 3 and 4 h.M. Torrent et al. RNase 3 and RNase ... concentration in the range 0.01–100 nM was incubated in the presence of 0.02 lg PGN in 200 lLof5mM Hepes-KOH (pH 7. 5) and the free and bound fractionswere quantiﬁed. RNase 3 and RNase 7 bactericidal...

Báo cáo khoa học: "Combining Lexical, Syntactic, and Semantic Features with Maximum Entropy Models for Extracting Relations" pptx

... Combining Lexical, Syntactic, and Semantic Features with Maximum Entropy Models for Extracting RelationsNanda KambhatlaIBM T. J. Watson Research Center1101 ... observations in section 4.2 Maximum Entropy models for extracting relationsWe built Maximum Entropy models for predictingthe type of relation (if any) between every pair ofmentions within each sentence. ... trees.We build Maximum Entropy models for extract-ing relations that combine diverse lexical, syntactic and semantic features. Our results indicate that us-ing a variety of information sources...

Báo cáo khoa học: "Comparison of an enzyme-linked immunosorbent assay with serum neutralization test for serodiagnosis of porcine epidemic diarrhea virus infection" pdf

...

Báo cáo khoa học: "High grade B-cell gastric lymphoma with complete pathologic remission after eradication of helicobacter pylori infection: Report of a case and review of the literature" pdf

... eradication of helicobacter pylori infection: Report of a case and review of the literatureLuigi Cavanna*1, Raffaella Pagani1, Pietro Seghini1, Adriano Zangrandi2 and Carlo Paties2Address: ... effect of eradication of Helicobacter pylori as firstline therapy in gastric high grade gastric lymphoma: 22 of a total of 38 (57.9%) enrolled patients obtained complete remission. Data of the ... partial remission after eradication treatment, gained complete regression of lymphoma after chemotherapy [15,22].Because of the advanced age, additional chemotherapywas postponed in a patient; "wait and...

Báo cáo khoa học: " Neoadjuvant capecitabine, radiotherapy, and bevacizumab (CRAB) in locally advanced rectal cancer: results of an open-label phase II study" docx

... RESEARCH Open Access Neoadjuvant capecitabine, radiotherapy, and bevacizumab (CRAB) in locally advanced rectal cancer: results of an open-label phase II studyVaneja Velenik1*, Janja Ocvirk1, ... safety and efficacy of bevacizumab in combination with che-motherapy and radiation in the neoadjuvant setting[30-34]. In this study we explored the safety and efficacy of neoadjuvant capecitabine, ... with5-fluorouracil and oxaliplatin versus 5-fluorouracil alone in locally advanced rectal cancer: first results of the German CAO/ARO/AIO-04randomized phase III trial. J Clin Oncol 2011, 29(suppl):Abst...

Báo cáo khoa học: " What is an acceptably smoothed fluence? Dosimetric and delivery considerations for dynamic sliding window IMRT" ppt

... OncologyOpen AccessResearch What is an acceptably smoothed fluence? Dosimetric and delivery considerations for dynamic sliding window IMRTNicolini Giorgia1, Fogliata Antonella1, Vanetti Eugenio1,2, ... conditions s25 and s80Figure 4DVHs of targets and organs at risk (Head and Neck case) for the two extreme smoothing conditions s25 and s80.Table 2: DVH analysis: differences between plans obtained ... by changing calculation algorithm (PBC and AAA) and dose calculation grid (2.5 mm and 5.0mm). Dose distributions were analysed in terms of DVH for the planning target volumes (PTV) and for the...

báo cáo khoa học: "Percutaneous pedicle screw reduction and axial presacral lumbar interbody fusion for treatment of lumbosacral spondylolisthesis: A case series" pdf

... 18-year history of axial low back pain and a one-year history of radiculopathy. The pain wasdescribed as 8 out of 10 on average and 10 out of 10 atits worst, of mechanical type, and refractory ... patients treatment alternatives with lower operative morbidity risk. The combination of percutaneous pedicle screw reduction and an axial presacral approach for lumbosacral discectomy and fusion offers ... follow-up.Conclusions: Percutaneous pedicle screw reduction combined with axial presacral lumbar interbody fusion offers a promising and minimally invasive alternative for the manag ement of lumbosacral spondylolisthesis.IntroductionPatients...

báo cáo khoa học:" Obesity and craniofacial variables in subjects with obstructive sleep apnea syndrome: comparisons of cephalometric values" ppsx

... 1 of 9(page number not for citation purposes)Head & Face MedicineOpen AccessReview Obesity and craniofacial variables in subjects with obstructive sleep apnea syndrome: comparisons of ... problems in the cognitivesphere. Apnea can be defined as an interruption of breath-ing during sleep, with persistence of thoracic and/ orabdominal movements associated with a decrease in oxy-gen ... Guilleminault C: Sleep and breathing. In Sleeping and waking disor-ders: indications and techniques Edited by: Guilleminault C. MenloPark,CA: Addison-Wesley Publishing; 1982:155-182. 3. Guilleminault...

báo cáo khoa học: " AtMRP6/AtABCC6, an ATP-Binding Cassette transporter gene expressed during early steps of seedling development and up-regulated by cadmium in Arabidopsis thaliana" doc

... are ABCtransporters [6,7].The ATP-binding cassette (ABC) superfamily is the largestfamily of transporters in living organisms, ranging frombacteria to humans [8-10]. In humans, ABC transportershave ... 1 of 11(page number not for citation purposes)BMC Plant BiologyOpen AccessResearch article AtMRP6/AtABCC6, an ATP-Binding Cassette transporter gene expressed during early steps of seedling ... normalizedaccording to the dry weight of samples.GSH, γ-EC and Phytochelatin levelsGSH, γ-EC and PC levels in roots and leaves of Cd-treated and untreated Atmrp6.1 and Atmrp6.2, and correspondingwild-type...

Xem thêm