Báo cáo khoa học: "Successful surgical correction of anal atresia in a transgenic cloned piglet" doc

...

Ngày tải lên: 07/08/2014, 18:21

... Kurokawa, Imizu, Toyama, Japan Fax: +81 766 56 2498 Tel: +81 766 56 7500 E-mail: tsakaki@pu-toyama.ac.jp Database Structural data are available in the Protein Data Bank database under the accession numbers ... PCR fragment containing R73V ⁄ R8 4A and FDX1 genes, with HindIII and PstI restriction sites, was prepared using the primers 5¢-ACCAAGCTTATGAAAAGATACCGCCAC- GACG-3¢ and 5 ¢-TTCTGCAGT...

Ngày tải lên: 15/03/2014, 23:20

... GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG HC-K 7A GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG MG3K6S GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC MG3K6S7K GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCC T3 ... ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC MG6S GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC MG6X GCCGGGATCCATGGGCGCAGCAGCANNKGCAGCAG...

Ngày tải lên: 16/03/2014, 16:20

... and pathological findings, and the surgical treatment of a case of atypical actinobacillosis in a cow. A 4-year-old female Jersey bovine who was not pregnant, and had been born and raised at ... Marco 1 Departments of 1 Veterinary Clinical Sciences, and 2 Veterinary Public Health and Animal Pathology, Faculty of Veterinary Medicine, Alma Mater Studiorum - University of...

Ngày tải lên: 07/08/2014, 23:22

... Sauerbruch LGH, et al: Littoral cell angioma as a rare cause of splenomegaly. Ann Hematol 2001, 80:45. 5. Oliver-Goldaracena JM, Blanco A, Miralles M, Martin-Gonzalez MA: Littoral cell angioma ... Titze 4 , Harald Paulus 5 and Matthias W Hoffmann 2 Abstract Background: Littoral cell angioma (LCA) is a rare vascular tumor of the spleen. Generally thought to be benign, additional cases...

Ngày tải lên: 09/08/2014, 02:21

... large with invasion of adjacent visceral and vascular structures. As such, accurate preoperative imaging is critical. In particular, assessment of the relationship between the tumor and adjacent ... within a hyalinized, well-vascularized stroma (Original magnification ×100)Figure 4 (A) Typical of pancreatic neuroendocrine tumors, this lesion contains interconnecting nests and trabe...

Ngày tải lên: 09/08/2014, 07:21

... and new information in formulating a paraphrase that differs in a meaningful way from the user's question. A description is also given of the transformational grammar used by the paraphraser ... question asked and not to a deviant version of it. The idea of using a paraphraser in the above way is not new. To date, other systems have used canned templates to...

Ngày tải lên: 21/02/2014, 20:20

... depends notably on the integration of the re-speak method (Imai et al., 2002) for a controlled acoustic environ- ment, automatic speaker adaptation and dynamic up- dates of language models and vocabularies, ... vocabularies, and was deemed acceptable by several Canadian broadcast- ers (RDS,CPAC,GTVA and TQS) who have adopted it over the past few years for captioning sports, pub- lic aff...

Ngày tải lên: 08/03/2014, 03:20

... Access Successful radiation treatment of anaplastic thyroid carcinoma metastatic to the right cardiac atrium and ventricle in a pacemaker-dependent patient Tina Dasgupta * , Igor J Barani, Mack ... treatment. As cardiac metastases are increasing in incidence, we detail the radiation methods used to treat these intracar- diac metastases, including specific precautions taken for the pac...

Ngày tải lên: 09/08/2014, 09:20

... PET/CT demonstrating the intracranial meningioma and its pulmonary metastases. Figure 2 SPECT/CT images of somatostatin r eceptor scintigraphy display avid uptake in the intracranial meningioma ( 2a and b) as ... contributions Conception of the case report: A. S., S.E., HJ.B.; Collection and assembly of data: H .A. , W.W., U.H.; Literature review and interpretation of data: A. S....

Ngày tải lên: 09/08/2014, 09:21