Báo cáo khoa học: "Establishment of a bovine leukemia virus-free dairy herd in Korea" potx
Báo cáo khoa học: "Establishment of a bovine leukemia virus-free dairy herd in Korea" potx
...
Ngày tải lên: 07/08/2014, 18:21
Báo cáo khoa học: "Establishment of a canine spinal cord injury model induced by epidural balloon compression" ppt
...
Ngày tải lên: 07/08/2014, 20:23
Báo cáo khoa hoc:"Association of a missense mutation in the bovine leptin gene with carcass fat content and leptin mRNA levels" pps
... A C A A T T G T C A C C A G G 3 6 - G A T G A C A C C A A A A C C C T C A T C A A G A C A A T T G T C A C C A G G 41- A T C A A T G A C A T C T C A C A C A C G 3 6 - A T C A A T G A C A T ... the alanine to valine substitution as well as an amino acid change from Glu to Arg in exon 3. Only two of the 106 F.C. Buchanan et al. or cent...
Ngày tải lên: 09/08/2014, 18:21
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx
... (Govt. of India) for partial financial support. The authors thank Dinesh Kumar for recording the scan- ning electron micrographs and Shivcharan Prasad and Pinakin Makwana for technical assistance. References 1 ... damage [33,34]. The co-administration of antioxidants like coenzyme Q and creatine has also been shown to be beneficial against a- synuclein aggregation in the substantia nigra...
Ngày tải lên: 14/02/2014, 19:20
Tài liệu Báo cáo khoa học: Properties of ecdysteroid receptors from diverse insect species in a heterologous cell culture system – a basis for screening novel insecticidal candidates docx
... dibenzoylhydrazines on larvicidal activity against the Colorado potato beetle Leptinotarsa decemlineata. Pest Manag Sci 57, 858–865. 36 Nakagawa Y, Minakuchi C, Takahashi K & Ueno T (2002) Inhibition of [3H] ... S1. Amino acid alignment of linker region and ligand-binding domain (LBD) of ecdysone receptors. Fig. S2. Amino acid alignment of linker region and ligand-binding domain (...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc
... GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC cyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG cyc1-z GCATCAGAAAGCATAGGC cyc1-m TGGGAATACGATAGAGTAG nb2 primer GTTTAAACGAGCTCGAATTC Coq7 in fission yeast R. ... GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG Spcoq3-y GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG Spcoq3-z GTATGCGATGTGGAATTTG Spcoq3-m GATGCCTTCCAATGAATTAC cyc1-w GAACCAATGAAATAAGGGCG cyc1...
Ngày tải lên: 18/02/2014, 14:20
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter. The ... organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura, Nobuaki Yoshida and Hirot...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf
... orientation of vitamin B 12 on binding and number of combining sites of human intrin- sic factor and the transcobalamins. Biochim Biophys Acta 243, 75–82. 12 Marchaj A, Jacobsen DW, Savon SR & ... E & Petersen TE (2002) Comparative analysis of cobalamin binding kinetics and ligand protection for intrinsic factor, transcobalamin, and haptocorrin. J Biol Chem 277, 9989–9996. 15...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Role of transcription factor activator protein 1 (AP1) in epidermal growth factor-mediated protection against apoptosis induced by a DNA-damaging agent doc
... expression of c-Fos and c-Jun, via the MAP kinase signaling pathway. TAM67 retains the DNA binding and leucine-zipper region of c-Jun, but it lacks the transactivation domain of c-Jun (amino acids 1–122). ... Healthcare). Caspase 9 activity assay Caspase 9 activity was examined according to the instruc- tion manual of the Caspase 9 ⁄ Mch6 Fluorometric Protease Assay kit (Medical and B...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt
... Miyamoto K, Tanaka K, Kawai M, Tainaka K, Imada C, Okami Y & Inamori Y (1993) Cloning and sequence of an alkaline serine protease-encoding gene from the marine bacterium Alteromonas sp. strain O-7. ... PCR was performed in 50 lL containing 1 ng of genomic DNA as template, 0.2 mm dATP, dCTP, dGTP and dTTP, 0.2 lm of upstream primer (OP17: 5¢-GA AAAACCATGGTGAATGAATACCAAGCGACT-3¢ ) a...
Ngày tải lên: 19/02/2014, 07:20